AT5G04080

Cysteine-rich TM module stress tolerance

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Forward (+)
1104524 .. 1105398
875 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G04080.2

Sequence Viewer

Length: 192 bp
ATGCAGGACATGAGAGATCAAAATCCTCCACAAGGATATCCAGCTGCAGAACAAGTATCTGAACAGCCTGGACAAGACAAGAAGAAGAAGAAACCACGGTTTTTCGAGACAAAGCAGAAAGGAGACAGAGGCTTCATTGAAGGATGTCTCTTTGCACTATGCTGCTGCTGGATTTGTGAAATGTGTTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

7.32

Weight (kDa)

7.54

Isoelectric Point (pI)

43.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 32
AgsI TTSAA 1 cut(s) 140
AjnI CCWGG 1 cut(s) 67
AluBI AGCT 1 cut(s) 44
AluI AGCT 1 cut(s) 44
Alw26I GTCTC 3 cut(s) 101, 117, 152
ApeKI GCWGC 3 cut(s) 44, 162, 165
BbvI GCAGC 3 cut(s) 31, 149, 152
BciT130I CCWGG 1 cut(s) 69
BcoDI GTCTC 3 cut(s) 101, 117, 152
BfmI CTRYAG 1 cut(s) 45
BisI GCNGC 3 cut(s) 45, 163, 166
BlsI GCNGC 3 cut(s) 46, 164, 167
Bme1390I CCNGG 1 cut(s) 69
BmrFI CCNGG 1 cut(s) 69
BsaBI GATNNNNATC 1 cut(s) 21
BsaJI CCNNGG 1 cut(s) 95
Bsc4I CCNNNNNNNGG 1 cut(s) 32
Bse8I GATNNNNATC 1 cut(s) 21
BseBI CCWGG 1 cut(s) 69
BseDI CCNNGG 1 cut(s) 95
BseGI GGATG 1 cut(s) 149
BseJI GATNNNNATC 1 cut(s) 21
BseLI CCNNNNNNNGG 1 cut(s) 32
BseXI GCAGC 3 cut(s) 31, 149, 152
BslI CCNNNNNNNGG 1 cut(s) 32
BsmAI GTCTC 3 cut(s) 101, 117, 152
Bsp143I GATC 1 cut(s) 16
BspMAI CTGCAG 1 cut(s) 49
BssECI CCNNGG 1 cut(s) 95
BssMI GATC 1 cut(s) 16
Bst2UI CCWGG 1 cut(s) 69
Bst4CI ACNGT 1 cut(s) 99
BstDSI CCRYGG 1 cut(s) 95
BstENI CCTNNNNNAGG 1 cut(s) 30
BstF5I GGATG 1 cut(s) 149
BstKTI GATC 1 cut(s) 19
BstMAI GTCTC 3 cut(s) 101, 117, 152
BstMBI GATC 1 cut(s) 16
BstNI CCWGG 1 cut(s) 69
BstSCI CCNGG 1 cut(s) 67
BstSFI CTRYAG 1 cut(s) 45
BstV1I GCAGC 3 cut(s) 31, 149, 152
BtgI CCRYGG 1 cut(s) 95
BtsCI GGATG 1 cut(s) 149
CviAII CATG 1 cut(s) 10
CviJI RGCY 3 cut(s) 44, 67, 132
CviKI_1 RGCY 3 cut(s) 44, 67, 132
DpnI GATC 1 cut(s) 18
DpnII GATC 1 cut(s) 16
Eco32I GATATC 1 cut(s) 38
EcoNI CCTNNNNNAGG 1 cut(s) 30
EcoRII CCWGG 1 cut(s) 67
EcoRV GATATC 1 cut(s) 38
FaeI CATG 1 cut(s) 13
FaiI YATR 2 cut(s) 11, 160
FatI CATG 1 cut(s) 9
Fnu4HI GCNGC 3 cut(s) 45, 163, 166
FokI GGATG 1 cut(s) 156
Fsp4HI GCNGC 3 cut(s) 45, 163, 166
GluI GCNGC 3 cut(s) 45, 163, 166
Hin1II CATG 1 cut(s) 13
Hpy188I TCNGA 1 cut(s) 61
Hpy188III TCNNGA 1 cut(s) 106
HpyAV CCTTC 1 cut(s) 134
HpyCH4III ACNGT 1 cut(s) 99
HpyCH4V TGCA 3 cut(s) 4, 47, 155
Hsp92II CATG 1 cut(s) 13
Kzo9I GATC 1 cut(s) 16
LpnPI CCDG 4 cut(s) 54, 54, 81, 154
Lsp1109I GCAGC 3 cut(s) 31, 149, 152
MalI GATC 1 cut(s) 18
MboI GATC 1 cut(s) 16
MboII GAAGA 3 cut(s) 94, 97, 100
MnlI CCTC 2 cut(s) 36, 122
MspA1I CMGCKG 1 cut(s) 44
MspR9I CCNGG 1 cut(s) 69
MvaI CCWGG 1 cut(s) 69
NdeII GATC 1 cut(s) 16
NlaIII CATG 1 cut(s) 13
PkrI GCNGC 3 cut(s) 46, 164, 167
Psp6I CCWGG 1 cut(s) 67
PspGI CCWGG 1 cut(s) 67
PstI CTGCAG 1 cut(s) 49
PvuII CAGCTG 1 cut(s) 44
SatI GCNGC 3 cut(s) 45, 163, 166
Sau3AI GATC 1 cut(s) 16
ScrFI CCNGG 1 cut(s) 69
SetI ASST 1 cut(s) 46
SfcI CTRYAG 1 cut(s) 45
StyD4I CCNGG 1 cut(s) 67
TaaI ACNGT 1 cut(s) 99
TaqI TCGA 1 cut(s) 105
TseI GCWGC 3 cut(s) 44, 162, 165
TspDTI ATGAA 1 cut(s) 124
XagI CCTNNNNNAGG 1 cut(s) 30
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.