AT5G40382

Cytochrome c oxidase subunit

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Reverse (-)
16155086 .. 16156221
1136 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G40382.1

Sequence Viewer

Length: 198 bp
ATGGCTAATGTTCAGAAGATCGGAAAGGCTGTTTATAAAGGACCAAGCGTAGTTAAAGAGATCATATATGGAATAACGCTCGGCTTTGCGGTTGGAGGGCTGTGGAAAATGCATCATTGGAACAACCAAAGACGAACGAAGGAGTTCTATGATTTACTCGAGAAGGGAGAAATTAGTGTTGTCGTCGAAGATGAGTAG
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

65

Amino Acids

7.42

Weight (kDa)

8.03

Isoelectric Point (pI)

48.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 36
AciI CCGC 1 cut(s) 89
Ama87I CYCGRG 1 cut(s) 158
Asp700I GAANNNNTTC 1 cut(s) 143
AspS9I GGNCC 1 cut(s) 41
AvaI CYCGRG 1 cut(s) 158
AvaII GGWCC 1 cut(s) 41
Bme18I GGWCC 1 cut(s) 41
BmeT110I CYCGRG 1 cut(s) 158
BmgT120I GGNCC 1 cut(s) 41
BmsI GCATC 1 cut(s) 121
BsiHKCI CYCGRG 1 cut(s) 158
BsoBI CYCGRG 1 cut(s) 158
Bsp143I GATC 2 cut(s) 18, 60
BspACI CCGC 1 cut(s) 89
BssMI GATC 2 cut(s) 18, 60
BstKTI GATC 2 cut(s) 21, 63
BstMBI GATC 2 cut(s) 18, 60
Cfr13I GGNCC 1 cut(s) 41
CviJI RGCY 4 cut(s) 5, 29, 84, 100
CviKI_1 RGCY 4 cut(s) 5, 29, 84, 100
DpnI GATC 2 cut(s) 20, 62
DpnII GATC 2 cut(s) 18, 60
Eco47I GGWCC 1 cut(s) 41
Eco88I CYCGRG 1 cut(s) 158
EcoT22I ATGCAT 1 cut(s) 114
FaiI YATR 5 cut(s) 36, 65, 67, 69, 150
Hpy188I TCNGA 2 cut(s) 15, 23
Hpy188III TCNNGA 1 cut(s) 160
Hpy99I CGWCG 1 cut(s) 188
HpyAV CCTTC 2 cut(s) 133, 157
HpyCH4V TGCA 1 cut(s) 112
Kzo9I GATC 2 cut(s) 18, 60
LweI GCATC 1 cut(s) 121
MalI GATC 2 cut(s) 20, 62
MboI GATC 2 cut(s) 18, 60
MboII GAAGA 1 cut(s) 28
MluCI AATT 1 cut(s) 171
MmeI TCCRAC 1 cut(s) 73
MnlI CCTC 1 cut(s) 89
Mph1103I ATGCAT 1 cut(s) 114
MroXI GAANNNNTTC 1 cut(s) 143
MseI TTAA 1 cut(s) 54
NdeII GATC 2 cut(s) 18, 60
NmeAIII GCCGAG 1 cut(s) 60
NsiI ATGCAT 1 cut(s) 114
PaeR7I CTCGAG 1 cut(s) 158
PdmI GAANNNNTTC 1 cut(s) 143
PsiI TTATAA 1 cut(s) 36
PspPI GGNCC 1 cut(s) 41
SaqAI TTAA 1 cut(s) 54
Sau3AI GATC 2 cut(s) 18, 60
Sau96I GGNCC 1 cut(s) 41
SfaNI GCATC 1 cut(s) 121
Sfr274I CTCGAG 1 cut(s) 158
SgeI CNNG 4 cut(s) 57, 92, 170, 172
SinI GGWCC 1 cut(s) 41
SlaI CTCGAG 1 cut(s) 158
SmlI CTYRAG 1 cut(s) 158
SmoI CTYRAG 1 cut(s) 158
Sse9I AATT 1 cut(s) 171
SsiI CCGC 1 cut(s) 89
TaqI TCGA 2 cut(s) 159, 186
TasI AATT 1 cut(s) 171
Tru1I TTAA 1 cut(s) 54
Tru9I TTAA 1 cut(s) 54
VpaK11BI GGWCC 1 cut(s) 41
XhoI CTCGAG 1 cut(s) 158
XmnI GAANNNNTTC 1 cut(s) 143
Zsp2I ATGCAT 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.