MD04G1041800.v1.1

Cytochrome C oxidase, subunit

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
Physical Location & Seq
Reverse (-)
4955430 .. 4956073
644 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1041800.v1.1.491

Sequence Viewer

Length: 192 bp
ATGGCGGCGGGTAGGGTGCCGCATCCGCCACTGAAAGGGCCGAACCTGGTGAAGGAGATAGCAATGGGAATTGCGGTGGCGATGGTGGCGGCGATGCCGTGGAAAATGTACCAATGGGATTTGCAGAAGAGGACCAGGACTATGTATGAGTTGCTCGACAAAGGTGAAGCAACTGTTGTTGCTCAAGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.04

Weight (kDa)

9.22

Isoelectric Point (pI)

43.54

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 16
AciI CCGC 6 cut(s) 5, 8, 20, 26, 74, 89
AfaI GTAC 1 cut(s) 110
AfiI CCNNNNNNNGG 2 cut(s) 35, 52
AjnI CCWGG 2 cut(s) 45, 134
AoxI GGCC 1 cut(s) 38
AspS9I GGNCC 2 cut(s) 38, 132
AsuHPI GGTGA 2 cut(s) 61, 176
AvaII GGWCC 1 cut(s) 132
BanI GGYRCC 1 cut(s) 16
BccI CCATC 1 cut(s) 76
BceAI ACGGC 1 cut(s) 82
BciT130I CCWGG 2 cut(s) 47, 136
BisI GCNGC 3 cut(s) 6, 20, 90
BlsI GCNGC 3 cut(s) 7, 21, 91
Bme1390I CCNGG 2 cut(s) 47, 136
Bme18I GGWCC 1 cut(s) 132
BmgT120I GGNCC 2 cut(s) 38, 132
BmiI GGNNCC 1 cut(s) 18
BmrFI CCNGG 2 cut(s) 47, 136
BmsI GCATC 2 cut(s) 31, 84
BpuEI CTTGAG 1 cut(s) 168
BsaJI CCNNGG 1 cut(s) 98
Bsc4I CCNNNNNNNGG 2 cut(s) 35, 52
Bse3DI GCAATG 1 cut(s) 69
BseBI CCWGG 2 cut(s) 47, 136
BseDI CCNNGG 1 cut(s) 98
BseGI GGATG 1 cut(s) 22
BseLI CCNNNNNNNGG 2 cut(s) 35, 52
BseMI GCAATG 1 cut(s) 69
BshFI GGCC 1 cut(s) 40
BshNI GGYRCC 1 cut(s) 16
BslI CCNNNNNNNGG 2 cut(s) 35, 52
BsnI GGCC 1 cut(s) 40
BspACI CCGC 6 cut(s) 5, 8, 20, 26, 74, 89
BspANI GGCC 1 cut(s) 40
BspLI GGNNCC 1 cut(s) 18
BspT107I GGYRCC 1 cut(s) 16
BsrDI GCAATG 1 cut(s) 69
BssECI CCNNGG 1 cut(s) 98
Bst2UI CCWGG 2 cut(s) 47, 136
Bst4CI ACNGT 1 cut(s) 175
Bst6I CTCTTC 1 cut(s) 122
BstDSI CCRYGG 1 cut(s) 98
BstENI CCTNNNNNAGG 1 cut(s) 50
BstF5I GGATG 1 cut(s) 22
BstMWI GCNNNNNNNGC 2 cut(s) 25, 86
BstNI CCWGG 2 cut(s) 47, 136
BstSCI CCNGG 2 cut(s) 45, 134
BsuRI GGCC 1 cut(s) 40
BtgI CCRYGG 1 cut(s) 98
BtgZI GCGATG 2 cut(s) 95, 107
BtsCI GGATG 1 cut(s) 22
BtsIMutI CAGTG 1 cut(s) 29
Cfr13I GGNCC 2 cut(s) 38, 132
CsiI ACCWGGT 1 cut(s) 45
Csp6I GTAC 1 cut(s) 109
CviJI RGCY 1 cut(s) 40
CviKI_1 RGCY 1 cut(s) 40
CviQI GTAC 1 cut(s) 109
Eam1104I CTCTTC 1 cut(s) 122
EarI CTCTTC 1 cut(s) 122
EciI GGCGGA 1 cut(s) 15
Eco47I GGWCC 1 cut(s) 132
EcoNI CCTNNNNNAGG 1 cut(s) 50
EcoRII CCWGG 2 cut(s) 45, 134
FaiI YATR 2 cut(s) 143, 147
Fnu4HI GCNGC 3 cut(s) 6, 20, 90
FokI GGATG 1 cut(s) 9
Fsp4HI GCNGC 3 cut(s) 6, 20, 90
GluI GCNGC 3 cut(s) 6, 20, 90
HaeIII GGCC 1 cut(s) 40
HphI GGTGA 2 cut(s) 61, 176
Hpy188III TCNNGA 1 cut(s) 185
HpyAV CCTTC 1 cut(s) 46
HpyCH4III ACNGT 1 cut(s) 175
HpyCH4V TGCA 1 cut(s) 124
HpyF10VI GCNNNNNNNGC 2 cut(s) 25, 86
LpnPI CCDG 4 cut(s) 32, 59, 121, 148
LweI GCATC 2 cut(s) 31, 84
MabI ACCWGGT 1 cut(s) 45
MboII GAAGA 1 cut(s) 139
MluCI AATT 1 cut(s) 69
MnlI CCTC 1 cut(s) 123
MspR9I CCNGG 2 cut(s) 47, 136
MvaI CCWGG 2 cut(s) 47, 136
MwoI GCNNNNNNNGC 2 cut(s) 25, 86
NlaIV GGNNCC 1 cut(s) 18
PkrI GCNGC 3 cut(s) 7, 21, 91
Psp6I CCWGG 2 cut(s) 45, 134
PspGI CCWGG 2 cut(s) 45, 134
PspN4I GGNNCC 1 cut(s) 18
PspPI GGNCC 2 cut(s) 38, 132
RsaI GTAC 1 cut(s) 110
RsaNI GTAC 1 cut(s) 109
SatI GCNGC 3 cut(s) 6, 20, 90
Sau96I GGNCC 2 cut(s) 38, 132
ScrFI CCNGG 2 cut(s) 47, 136
SetI ASST 2 cut(s) 48, 166
SexAI ACCWGGT 1 cut(s) 45
SfaNI GCATC 2 cut(s) 31, 84
SgeI CNNG 7 cut(s) 21, 58, 59, 111, 147, 148, 167
SinI GGWCC 1 cut(s) 132
SmlI CTYRAG 1 cut(s) 183
SmoI CTYRAG 1 cut(s) 183
Sse9I AATT 1 cut(s) 69
SsiI CCGC 6 cut(s) 5, 8, 20, 26, 74, 89
StyD4I CCNGG 2 cut(s) 45, 134
TaaI ACNGT 1 cut(s) 175
TaqI TCGA 1 cut(s) 156
TasI AATT 1 cut(s) 69
TauI GCSGC 3 cut(s) 8, 22, 92
TscAI CASTG 1 cut(s) 36
TspRI CASTG 1 cut(s) 36
VpaK11BI GGWCC 1 cut(s) 132
XagI CCTNNNNNAGG 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.