Prupe.3G288700_v2.0.a1

Cytochrome c oxidase subunit

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
Physical Location & Seq
Reverse (-)
25981760 .. 25982565
806 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G288700.1

Sequence Viewer

Length: 162 bp
ATGGGTCCAAGTATAGTGAAGGAGATCATATATGGGGCAACGATTGGGCTGTCGGTTGGGTTTCTTTGGAAAATGTATCACTGGAATCTTCAGAGGAGAACCAAGGAATTTTATGAGCTGCTCGATAGAGGCGAAATCTCCACTGTTGTCGAAGATGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.21

Weight (kDa)

5.19

Isoelectric Point (pI)

53.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 107
AcuI CTGAAG 1 cut(s) 74
AluBI AGCT 1 cut(s) 118
AluI AGCT 1 cut(s) 118
ApeKI GCWGC 1 cut(s) 118
ApoI RAATTY 1 cut(s) 107
AspS9I GGNCC 1 cut(s) 5
AvaII GGWCC 1 cut(s) 5
BbvI GCAGC 1 cut(s) 105
BfaI CTAG 1 cut(s) 160
BisI GCNGC 1 cut(s) 119
BlsI GCNGC 1 cut(s) 120
Bme18I GGWCC 1 cut(s) 5
BmgT120I GGNCC 1 cut(s) 5
BmiI GGNNCC 1 cut(s) 6
BsaJI CCNNGG 1 cut(s) 102
Bse1I ACTGG 1 cut(s) 86
BseDI CCNNGG 1 cut(s) 102
BseNI ACTGG 1 cut(s) 86
BseRI GAGGAG 1 cut(s) 109
BseXI GCAGC 1 cut(s) 105
Bsp143I GATC 1 cut(s) 24
BspLI GGNNCC 1 cut(s) 6
BsrI ACTGG 1 cut(s) 86
BssECI CCNNGG 1 cut(s) 102
BssMI GATC 1 cut(s) 24
BssT1I CCWWGG 1 cut(s) 102
Bst4CI ACNGT 1 cut(s) 145
BstKTI GATC 1 cut(s) 27
BstMBI GATC 1 cut(s) 24
BstV1I GCAGC 1 cut(s) 105
BtsIMutI CAGTG 2 cut(s) 79, 141
Cfr13I GGNCC 1 cut(s) 5
CviJI RGCY 2 cut(s) 49, 118
CviKI_1 RGCY 2 cut(s) 49, 118
DpnI GATC 1 cut(s) 26
DpnII GATC 1 cut(s) 24
Eco130I CCWWGG 1 cut(s) 102
Eco47I GGWCC 1 cut(s) 5
Eco57I CTGAAG 1 cut(s) 74
EcoT14I CCWWGG 1 cut(s) 102
ErhI CCWWGG 1 cut(s) 102
FaiI YATR 5 cut(s) 14, 29, 31, 33, 114
Fnu4HI GCNGC 1 cut(s) 119
Fsp4HI GCNGC 1 cut(s) 119
FspBI CTAG 1 cut(s) 160
GluI GCNGC 1 cut(s) 119
HinfI GANTC 1 cut(s) 85
Hpy188I TCNGA 1 cut(s) 93
HpyAV CCTTC 1 cut(s) 13
HpyCH4III ACNGT 1 cut(s) 145
Kzo9I GATC 1 cut(s) 24
LpnPI CCDG 1 cut(s) 67
Lsp1109I GCAGC 1 cut(s) 105
MaeI CTAG 1 cut(s) 160
MalI GATC 1 cut(s) 26
MboI GATC 1 cut(s) 24
MboII GAAGA 1 cut(s) 80
MluCI AATT 1 cut(s) 107
MnlI CCTC 2 cut(s) 87, 122
NdeII GATC 1 cut(s) 24
NlaIV GGNNCC 1 cut(s) 6
PcsI WCGNNNNNNNCGW 1 cut(s) 129
PfeI GAWTC 1 cut(s) 85
PkrI GCNGC 1 cut(s) 120
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 5
SatI GCNGC 1 cut(s) 119
Sau3AI GATC 1 cut(s) 24
Sau96I GGNCC 1 cut(s) 5
SetI ASST 1 cut(s) 120
SgeI CNNG 4 cut(s) 21, 94, 115, 134
SinI GGWCC 1 cut(s) 5
Sse9I AATT 1 cut(s) 107
SspMI CTAG 1 cut(s) 160
StyI CCWWGG 1 cut(s) 102
TaaI ACNGT 1 cut(s) 145
TaqI TCGA 2 cut(s) 123, 150
TasI AATT 1 cut(s) 107
TfiI GAWTC 1 cut(s) 85
TscAI CASTG 2 cut(s) 86, 148
TseI GCWGC 1 cut(s) 118
TspRI CASTG 2 cut(s) 86, 148
VpaK11BI GGWCC 1 cut(s) 5
XapI RAATTY 1 cut(s) 107
XspI CTAG 1 cut(s) 160
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.