Prupe.1G195500_v2.0.a1

Cytochrome C oxidase, subunit

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Reverse (-)
18517851 .. 18519750
1900 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G195500.1

Sequence Viewer

Length: 189 bp
ATGGCAGGTAGGGCTGCTCATCCCACCCTGAAAGGACCAAGCGTGATCAGGGAGATATGTTTTGGTGTTGTGATTGCTTTTGCTGCTGGGAGCTTTTGGAAAATGTATCACTGGGATTTGCAGAAGAAGACCAGGTCATTTTATGAATTGCTGGAGAAAGATGAAATCAGTGTTGTTGCAGATGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.05

Weight (kDa)

6.72

Isoelectric Point (pI)

42.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 131
AluBI AGCT 1 cut(s) 93
AluI AGCT 1 cut(s) 93
ApeKI GCWGC 2 cut(s) 14, 83
AspS9I GGNCC 1 cut(s) 35
AvaII GGWCC 1 cut(s) 35
BbsI GAAGAC 1 cut(s) 134
BbvI GCAGC 1 cut(s) 70
BciT130I CCWGG 1 cut(s) 133
BclI TGATCA 1 cut(s) 45
BisI GCNGC 2 cut(s) 15, 84
BlsI GCNGC 2 cut(s) 16, 85
Bme1390I CCNGG 1 cut(s) 133
Bme18I GGWCC 1 cut(s) 35
BmgT120I GGNCC 1 cut(s) 35
BmrFI CCNGG 1 cut(s) 133
BmrI ACTGGG 1 cut(s) 121
BmuI ACTGGG 1 cut(s) 121
BpiI GAAGAC 1 cut(s) 134
BpmI CTGGAG 1 cut(s) 173
Bse1I ACTGG 1 cut(s) 116
BseBI CCWGG 1 cut(s) 133
BseGI GGATG 1 cut(s) 19
BseNI ACTGG 1 cut(s) 116
BseXI GCAGC 1 cut(s) 70
BseYI CCCAGC 1 cut(s) 86
Bsp143I GATC 1 cut(s) 45
BsrI ACTGG 1 cut(s) 116
BssMI GATC 1 cut(s) 45
Bst2UI CCWGG 1 cut(s) 133
BstF5I GGATG 1 cut(s) 19
BstKTI GATC 1 cut(s) 48
BstMBI GATC 1 cut(s) 45
BstMWI GCNNNNNNNGC 2 cut(s) 11, 83
BstNI CCWGG 1 cut(s) 133
BstSCI CCNGG 1 cut(s) 131
BstV1I GCAGC 1 cut(s) 70
BstV2I GAAGAC 1 cut(s) 134
BtsCI GGATG 1 cut(s) 19
BtsIMutI CAGTG 2 cut(s) 109, 175
Cfr13I GGNCC 1 cut(s) 35
CsiI ACCWGGT 1 cut(s) 131
CviJI RGCY 2 cut(s) 14, 93
CviKI_1 RGCY 2 cut(s) 14, 93
DpnI GATC 1 cut(s) 47
DpnII GATC 1 cut(s) 45
Eco47I GGWCC 1 cut(s) 35
EcoRII CCWGG 1 cut(s) 131
FaiI YATR 2 cut(s) 58, 144
FbaI TGATCA 1 cut(s) 45
Fnu4HI GCNGC 2 cut(s) 15, 84
FokI GGATG 1 cut(s) 6
Fsp4HI GCNGC 2 cut(s) 15, 84
GluI GCNGC 2 cut(s) 15, 84
GsaI CCCAGC 1 cut(s) 90
GsuI CTGGAG 1 cut(s) 173
HpyCH4V TGCA 2 cut(s) 121, 179
HpyF10VI GCNNNNNNNGC 2 cut(s) 11, 83
Ksp22I TGATCA 1 cut(s) 45
Kzo9I GATC 1 cut(s) 45
LmnI GCTCC 1 cut(s) 90
LpnPI CCDG 7 cut(s) 34, 41, 72, 97, 118, 137, 145
Lsp1109I GCAGC 1 cut(s) 70
MabI ACCWGGT 1 cut(s) 131
MalI GATC 1 cut(s) 47
MboI GATC 1 cut(s) 45
MboII GAAGA 2 cut(s) 136, 139
MluCI AATT 1 cut(s) 146
MspR9I CCNGG 1 cut(s) 133
MvaI CCWGG 1 cut(s) 133
MwoI GCNNNNNNNGC 2 cut(s) 11, 83
NdeII GATC 1 cut(s) 45
PflFI GACNNNGTC 1 cut(s) 133
PkrI GCNGC 2 cut(s) 16, 85
Psp6I CCWGG 1 cut(s) 131
PspFI CCCAGC 1 cut(s) 86
PspGI CCWGG 1 cut(s) 131
PspPI GGNCC 1 cut(s) 35
PsyI GACNNNGTC 1 cut(s) 133
SatI GCNGC 2 cut(s) 15, 84
Sau3AI GATC 1 cut(s) 45
Sau96I GGNCC 1 cut(s) 35
ScrFI CCNGG 1 cut(s) 133
SetI ASST 3 cut(s) 10, 95, 137
SexAI ACCWGGT 1 cut(s) 131
SinI GGWCC 1 cut(s) 35
Sse9I AATT 1 cut(s) 146
StyD4I CCNGG 1 cut(s) 131
TasI AATT 1 cut(s) 146
TscAI CASTG 2 cut(s) 116, 175
TseI GCWGC 2 cut(s) 14, 83
TspDTI ATGAA 2 cut(s) 159, 177
TspRI CASTG 2 cut(s) 116, 175
Tth111I GACNNNGTC 1 cut(s) 133
VpaK11BI GGWCC 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.