FvH4_2g04400

ubiE/COQ5 methyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
OG0007355
Physical Location & Seq
Forward (+)
3400646 .. 3401529
884 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g04400.t1

Sequence Viewer

Length: 327 bp
ATGCTGGACATGTGTAGCAGTTGGGTCAGTCACTTTCCTCCGGGATACAAGCAAGAGCGAGTAGTTGGAATGGGAATGATTGAAGCAGAGCTAAAGGCAAATCCGGTTTTGACAGAGTATGTTCTTCAAGACTTGAATGGCGATCCTAAACTTCCCTTTGAAGATAATTCTTTCGATGTGATAACTAATGTGGTCAGTGTTGATTATATTAACAAGCCTAATGAAGTTTTCAAGGAAATGTGCTGGATTCTTAAGCCAGGCAGACTTGCTATAATGAGGTGTCATCTTAAGTGTAGATACACAATTTCAATCATCCCTTACCCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Methyltransf_11

Protein Analysis

109

Amino Acids

12.44

Weight (kDa)

5.6

Isoelectric Point (pI)

32.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Methyltransf_11 PF08241 31 - 88 8.6e-09 Methyltransferase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 137
AflII CTTAAG 2 cut(s) 251, 287
AflIII ACRYGT 1 cut(s) 9
AgsI TTSAA 6 cut(s) 83, 128, 136, 161, 232, 309
AjnI CCWGG 1 cut(s) 256
AluBI AGCT 1 cut(s) 91
AluI AGCT 1 cut(s) 91
AlwI GGATC 1 cut(s) 137
AsuC2I CCSGG 1 cut(s) 42
BciT130I CCWGG 1 cut(s) 258
BciVI GTATCC 1 cut(s) 38
BcnI CCSGG 1 cut(s) 42
BfrI CTTAAG 2 cut(s) 251, 287
BfuI GTATCC 1 cut(s) 38
Bme1390I CCNGG 2 cut(s) 42, 258
BmrFI CCNGG 2 cut(s) 42, 258
BpuMI CCSGG 1 cut(s) 42
BsaWI WCCGGW 1 cut(s) 103
BseBI CCWGG 1 cut(s) 258
BseGI GGATG 1 cut(s) 312
BsiSI CCGG 2 cut(s) 41, 104
Bsp143I GATC 1 cut(s) 142
BspPI GGATC 1 cut(s) 137
BspTI CTTAAG 2 cut(s) 251, 287
BssMI GATC 1 cut(s) 142
Bst2UI CCWGG 1 cut(s) 258
BstAFI CTTAAG 2 cut(s) 251, 287
BstDEI CTNAG 1 cut(s) 324
BstF5I GGATG 1 cut(s) 312
BstKTI GATC 1 cut(s) 145
BstMBI GATC 1 cut(s) 142
BstNI CCWGG 1 cut(s) 258
BstNSI RCATGY 1 cut(s) 13
BstSCI CCNGG 2 cut(s) 40, 256
BsuI GTATCC 1 cut(s) 38
BtsCI GGATG 1 cut(s) 312
BtsIMutI CAGTG 1 cut(s) 202
CviAII CATG 1 cut(s) 10
CviJI RGCY 3 cut(s) 91, 217, 256
CviKI_1 RGCY 3 cut(s) 91, 217, 256
DdeI CTNAG 1 cut(s) 324
DpnI GATC 1 cut(s) 144
DpnII GATC 1 cut(s) 142
EcoRII CCWGG 1 cut(s) 256
FaeI CATG 1 cut(s) 13
FaiI YATR 4 cut(s) 11, 120, 207, 272
FatI CATG 1 cut(s) 9
FokI GGATG 1 cut(s) 299
HapII CCGG 2 cut(s) 41, 104
Hin1II CATG 1 cut(s) 13
HinfI GANTC 1 cut(s) 247
HpaII CCGG 2 cut(s) 41, 104
Hpy188III TCNNGA 1 cut(s) 128
HpyF3I CTNAG 1 cut(s) 324
Hsp92II CATG 1 cut(s) 13
Kzo9I GATC 1 cut(s) 142
LpnPI CCDG 5 cut(s) 54, 117, 229, 243, 270
MaeIII GTNAC 1 cut(s) 29
MalI GATC 1 cut(s) 144
MboI GATC 1 cut(s) 142
MboII GAAGA 2 cut(s) 116, 173
MluCI AATT 2 cut(s) 166, 303
MmeI TCCRAC 1 cut(s) 46
MnlI CCTC 2 cut(s) 48, 270
MseI TTAA 3 cut(s) 210, 252, 288
MspCI CTTAAG 2 cut(s) 251, 287
MspI CCGG 2 cut(s) 41, 104
MspR9I CCNGG 2 cut(s) 42, 258
MvaI CCWGG 1 cut(s) 258
NciI CCSGG 1 cut(s) 42
NdeII GATC 1 cut(s) 142
NlaIII CATG 1 cut(s) 13
NmuCI GTSAC 1 cut(s) 29
NspI RCATGY 1 cut(s) 13
PciI ACATGT 1 cut(s) 9
PfeI GAWTC 1 cut(s) 247
PfoI TCCNGGA 1 cut(s) 40
PscI ACATGT 1 cut(s) 9
Psp6I CCWGG 1 cut(s) 256
PspGI CCWGG 1 cut(s) 256
SaqAI TTAA 3 cut(s) 210, 252, 288
Sau3AI GATC 1 cut(s) 142
ScrFI CCNGG 2 cut(s) 42, 258
SetI ASST 2 cut(s) 93, 281
SmlI CTYRAG 2 cut(s) 251, 287
SmoI CTYRAG 2 cut(s) 251, 287
Sse9I AATT 2 cut(s) 166, 303
StyD4I CCNGG 2 cut(s) 40, 256
TaqI TCGA 1 cut(s) 174
TasI AATT 2 cut(s) 166, 303
TfiI GAWTC 1 cut(s) 247
Tru1I TTAA 3 cut(s) 210, 252, 288
Tru9I TTAA 3 cut(s) 210, 252, 288
TscAI CASTG 1 cut(s) 202
TseFI GTSAC 1 cut(s) 29
Tsp45I GTSAC 1 cut(s) 29
TspDTI ATGAA 1 cut(s) 237
TspRI CASTG 1 cut(s) 202
Vha464I CTTAAG 2 cut(s) 251, 287
XceI RCATGY 1 cut(s) 13
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.