FvH4_2g24200

Cell wall vacuolar inhibitor of fructosidase 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
OG0016266
Physical Location & Seq
Reverse (-)
19754311 .. 19754754
444 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g24200.t1

Sequence Viewer

Length: 444 bp
ATGGATGAGAATCTCATCAAGGAAACATGCAGAAAGACACCAGACTATGATATCTGTCTCTATCTGCTTAAATATAATGGTGGCAGCGGGATCTATTCTGCAAATCGCACACGCTTGGCGGATGTAATGATCGATGTAGTCGGGCTTAGAGCAACCGATGCTCTAAACAAAGTTGAGGAGCTTCTAAGCAAAACACCAGAAGATCGACCTTTAACACAATGTAGCACACAATACACATATATTACATCAACTATGGTTCCGTATGCCAAGATGTATGCTTATACGAACCCTCATGCAGCAGGATATTTGATGCATGGCATTCAAGACAAGGCTGTGAAATATTGTGAAGATTTATTCAGAGGGTCGTCTCCTCTTACTGACTGGAATCTAGGTGTCCAAAAGGTTGCTGCTATTGCTGAAGCAATAATAGGGCAATTGGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PMEI

Protein Analysis

148

Amino Acids

16.37

Weight (kDa)

5.64

Isoelectric Point (pI)

28.92

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PMEI PF04043 4 - 84 3.2e-10 Plant invertase/pectin methylesterase inhibitor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 87, 119
AclWI GGATC 1 cut(s) 98
AcuI CTGAAG 1 cut(s) 438
AgsI TTSAA 1 cut(s) 323
AluBI AGCT 1 cut(s) 181
AluI AGCT 1 cut(s) 181
Alw26I GTCTC 2 cut(s) 62, 372
AlwI GGATC 1 cut(s) 98
ApeKI GCWGC 3 cut(s) 84, 296, 407
BbvI GCAGC 3 cut(s) 96, 308, 394
BcoDI GTCTC 2 cut(s) 62, 372
BfaI CTAG 1 cut(s) 389
BisI GCNGC 3 cut(s) 85, 297, 408
BlsI GCNGC 3 cut(s) 86, 298, 409
BmiI GGNNCC 1 cut(s) 258
BmsI GCATC 2 cut(s) 148, 300
Bsa29I ATCGAT 1 cut(s) 132
BsaBI GATNNNNATC 1 cut(s) 9
Bse1I ACTGG 1 cut(s) 386
Bse8I GATNNNNATC 1 cut(s) 9
BseCI ATCGAT 1 cut(s) 132
BseGI GGATG 2 cut(s) 10, 127
BseJI GATNNNNATC 1 cut(s) 9
BseNI ACTGG 1 cut(s) 386
BseRI GAGGAG 2 cut(s) 191, 360
BseXI GCAGC 3 cut(s) 96, 308, 394
BshVI ATCGAT 1 cut(s) 132
BsmAI GTCTC 2 cut(s) 62, 372
BsmBI CGTCTC 1 cut(s) 372
BsmI GAATGC 1 cut(s) 318
Bsp143I GATC 3 cut(s) 90, 129, 202
BspACI CCGC 2 cut(s) 87, 119
BspDI ATCGAT 1 cut(s) 132
BspLI GGNNCC 1 cut(s) 258
BspPI GGATC 1 cut(s) 98
BsrI ACTGG 1 cut(s) 386
BssMI GATC 3 cut(s) 90, 129, 202
BstAPI GCANNNNNTGC 1 cut(s) 158
BstDEI CTNAG 2 cut(s) 146, 185
BstF5I GGATG 2 cut(s) 10, 127
BstKTI GATC 3 cut(s) 93, 132, 205
BstMAI GTCTC 2 cut(s) 62, 372
BstMBI GATC 3 cut(s) 90, 129, 202
BstMWI GCNNNNNNNGC 2 cut(s) 158, 413
BstNSI RCATGY 1 cut(s) 30
BstV1I GCAGC 3 cut(s) 96, 308, 394
BstX2I RGATCY 1 cut(s) 90
BstYI RGATCY 1 cut(s) 90
Bsu15I ATCGAT 1 cut(s) 132
BsuTUI ATCGAT 1 cut(s) 132
BtsCI GGATG 2 cut(s) 10, 127
ClaI ATCGAT 1 cut(s) 132
CviAII CATG 3 cut(s) 27, 293, 314
CviJI RGCY 3 cut(s) 145, 181, 332
CviKI_1 RGCY 3 cut(s) 145, 181, 332
DdeI CTNAG 2 cut(s) 146, 185
DpnI GATC 3 cut(s) 92, 131, 204
DpnII GATC 3 cut(s) 90, 129, 202
EciI GGCGGA 1 cut(s) 134
Eco32I GATATC 1 cut(s) 52
Eco57I CTGAAG 1 cut(s) 438
EcoRV GATATC 1 cut(s) 52
EcoT22I ATGCAT 1 cut(s) 315
Esp3I CGTCTC 1 cut(s) 372
FaeI CATG 3 cut(s) 30, 296, 317
FatI CATG 3 cut(s) 26, 292, 313
FauI CCCGC 1 cut(s) 80
Fnu4HI GCNGC 3 cut(s) 85, 297, 408
FokI GGATG 2 cut(s) 17, 134
Fsp4HI GCNGC 3 cut(s) 85, 297, 408
FspBI CTAG 1 cut(s) 389
GluI GCNGC 3 cut(s) 85, 297, 408
Hin1II CATG 3 cut(s) 30, 296, 317
HinfI GANTC 2 cut(s) 10, 385
Hpy188I TCNGA 1 cut(s) 359
Hpy188III TCNNGA 1 cut(s) 323
HpyCH4V TGCA 4 cut(s) 30, 101, 296, 313
HpyF10VI GCNNNNNNNGC 2 cut(s) 158, 413
HpyF3I CTNAG 2 cut(s) 146, 185
Hsp92II CATG 3 cut(s) 30, 296, 317
Kzo9I GATC 3 cut(s) 90, 129, 202
LmnI GCTCC 1 cut(s) 178
LpnPI CCDG 4 cut(s) 54, 210, 285, 367
Lsp1109I GCAGC 3 cut(s) 96, 308, 394
LweI GCATC 2 cut(s) 148, 300
MaeI CTAG 1 cut(s) 389
MalI GATC 3 cut(s) 92, 131, 204
MboI GATC 3 cut(s) 90, 129, 202
MboII GAAGA 2 cut(s) 212, 359
MfeI CAATTG 1 cut(s) 434
MflI RGATCY 1 cut(s) 90
MluCI AATT 1 cut(s) 434
MnlI CCTC 4 cut(s) 169, 300, 353, 381
Mph1103I ATGCAT 1 cut(s) 315
MseI TTAA 3 cut(s) 69, 212, 442
MspA1I CMGCKG 1 cut(s) 87
MunI CAATTG 1 cut(s) 434
Mva1269I GAATGC 1 cut(s) 318
MwoI GCNNNNNNNGC 2 cut(s) 158, 413
NdeII GATC 3 cut(s) 90, 129, 202
NlaIII CATG 3 cut(s) 30, 296, 317
NlaIV GGNNCC 1 cut(s) 258
NsiI ATGCAT 1 cut(s) 315
NspI RCATGY 1 cut(s) 30
PctI GAATGC 1 cut(s) 318
PfeI GAWTC 2 cut(s) 10, 385
PkrI GCNGC 3 cut(s) 86, 298, 409
PspN4I GGNNCC 1 cut(s) 258
PsuI RGATCY 1 cut(s) 90
SaqAI TTAA 3 cut(s) 69, 212, 442
SatI GCNGC 3 cut(s) 85, 297, 408
Sau3AI GATC 3 cut(s) 90, 129, 202
SetI ASST 4 cut(s) 183, 211, 394, 405
SfaNI GCATC 2 cut(s) 148, 300
Sse9I AATT 1 cut(s) 434
SsiI CCGC 2 cut(s) 87, 119
SspI AATATT 1 cut(s) 341
SspMI CTAG 1 cut(s) 389
TaqI TCGA 2 cut(s) 132, 205
TasI AATT 1 cut(s) 434
TfiI GAWTC 2 cut(s) 10, 385
Tru1I TTAA 3 cut(s) 69, 212, 442
Tru9I TTAA 3 cut(s) 69, 212, 442
TseI GCWGC 3 cut(s) 84, 296, 407
TspGWI ACGGA 1 cut(s) 249
XceI RCATGY 1 cut(s) 30
XspI CTAG 1 cut(s) 389
Zsp2I ATGCAT 1 cut(s) 315
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.