Rw7G031080

Cell wall vacuolar inhibitor of fructosidase 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
OG0016266
Physical Location & Seq
Reverse (-)
44248525 .. 44249061
537 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G031080.1

Sequence Viewer

Length: 537 bp
ATGAATCCATCAACCCCCATATTTCTCATTCAACTTATTTGTTTTCTCATATTCCTTCCAATAAGCCAATGCAGCCAAGTTTTCTTTCCAATGGACCAAAATCTTATTGAGGAAACATGCAGAAAGACACCAGACTACGATCTATGTATCTTTTATTTTAAATCGACCAGTGATAGTGGGATCTTGACTGCAAATCGCACACGCTTGGCCGACGTAATGATTGATGTAGTCCGGCAGATATCAACCAATACTCGGAAAAAAATTGATGAGCTTCTTGGTAAAACACCTGGAGATAAACCGTTAACTACATGTCTTGTATATTACTATACGATCGTAAGCCATTATATCCCGGCGGCCAAGAAGACAATTTATACGAGTGATCGTAAGGTGGCAGGGAGACTAATTGGTCACATTCCAAATGTTGCAAAATCATGTGAGGATTCATTCAGAGGCAATCCGTCTCCTCTTACTGACTTGAATATATTTGTCCAAAAGGTTGCAGCTATTACTGCAGCAATAATAGGGCAATTGGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PMEI

Protein Analysis

178

Amino Acids

19.87

Weight (kDa)

8.73

Isoelectric Point (pI)

33.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PMEI PF04043 34 - 172 2.5e-10 Plant invertase/pectin methylesterase inhibitor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 405
AciI CCGC 1 cut(s) 353
AclWI GGATC 1 cut(s) 188
AcoI YGGCCR 2 cut(s) 207, 354
AfiI CCNNNNNNNGG 1 cut(s) 252
AflIII ACRYGT 1 cut(s) 308
AgsI TTSAA 2 cut(s) 32, 478
AjnI CCWGG 1 cut(s) 286
AjuI GAANNNNNNNTTGG 2 cut(s) 69, 101
AluBI AGCT 2 cut(s) 271, 503
AluI AGCT 2 cut(s) 271, 503
Alw26I GTCTC 2 cut(s) 391, 465
AlwI GGATC 1 cut(s) 188
AoxI GGCC 2 cut(s) 207, 354
ApeKI GCWGC 3 cut(s) 72, 500, 512
AspS9I GGNCC 1 cut(s) 94
AsuC2I CCSGG 1 cut(s) 350
AvaII GGWCC 1 cut(s) 94
BbsI GAAGAC 1 cut(s) 368
BbvI GCAGC 3 cut(s) 84, 512, 524
BccI CCATC 1 cut(s) 16
BciT130I CCWGG 1 cut(s) 288
BcnI CCSGG 1 cut(s) 350
BcoDI GTCTC 2 cut(s) 391, 465
BfmI CTRYAG 1 cut(s) 510
BisI GCNGC 4 cut(s) 73, 354, 501, 513
BlsI GCNGC 4 cut(s) 74, 355, 502, 514
Bme1390I CCNGG 2 cut(s) 288, 350
Bme18I GGWCC 1 cut(s) 94
BmgT120I GGNCC 1 cut(s) 94
BmrFI CCNGG 2 cut(s) 288, 350
BpiI GAAGAC 1 cut(s) 368
BpmI CTGGAG 1 cut(s) 309
BpuMI CCSGG 1 cut(s) 350
Bsc4I CCNNNNNNNGG 1 cut(s) 252
Bse1I ACTGG 1 cut(s) 168
BseBI CCWGG 1 cut(s) 288
BseLI CCNNNNNNNGG 1 cut(s) 252
BseNI ACTGG 1 cut(s) 168
BseRI GAGGAG 1 cut(s) 453
BseXI GCAGC 3 cut(s) 84, 512, 524
Bsh1285I CGRYCG 1 cut(s) 333
BshFI GGCC 2 cut(s) 209, 356
BsiEI CGRYCG 1 cut(s) 333
BsiSI CCGG 2 cut(s) 232, 350
BslI CCNNNNNNNGG 1 cut(s) 252
BsmAI GTCTC 2 cut(s) 391, 465
BsmBI CGTCTC 1 cut(s) 465
BsnI GGCC 2 cut(s) 209, 356
Bsp143I GATC 4 cut(s) 139, 180, 330, 379
BspACI CCGC 1 cut(s) 353
BspANI GGCC 2 cut(s) 209, 356
BspMAI CTGCAG 1 cut(s) 514
BspPI GGATC 1 cut(s) 188
BsrI ACTGG 1 cut(s) 168
BssMI GATC 4 cut(s) 139, 180, 330, 379
Bst2UI CCWGG 1 cut(s) 288
Bst4CI ACNGT 1 cut(s) 300
BstKTI GATC 4 cut(s) 142, 183, 333, 382
BstMAI GTCTC 2 cut(s) 391, 465
BstMBI GATC 4 cut(s) 139, 180, 330, 379
BstMCI CGRYCG 1 cut(s) 333
BstMWI GCNNNNNNNGC 2 cut(s) 72, 509
BstNI CCWGG 1 cut(s) 288
BstNSI RCATGY 2 cut(s) 120, 312
BstSCI CCNGG 2 cut(s) 286, 348
BstSFI CTRYAG 1 cut(s) 510
BstV1I GCAGC 3 cut(s) 84, 512, 524
BstV2I GAAGAC 1 cut(s) 368
BstX2I RGATCY 1 cut(s) 180
BstYI RGATCY 1 cut(s) 180
BsuRI GGCC 2 cut(s) 209, 356
BtsIMutI CAGTG 1 cut(s) 175
Cfr13I GGNCC 1 cut(s) 94
CviAII CATG 3 cut(s) 117, 309, 432
CviJI RGCY 7 cut(s) 66, 75, 209, 271, 339, 356, 503
CviKI_1 RGCY 7 cut(s) 66, 75, 209, 271, 339, 356, 503
DpnI GATC 4 cut(s) 141, 182, 332, 381
DpnII GATC 4 cut(s) 139, 180, 330, 379
DraI TTTAAA 1 cut(s) 160
DrdI GACNNNNNNGTC 1 cut(s) 405
DseDI GACNNNNNNGTC 1 cut(s) 405
EaeI YGGCCR 2 cut(s) 207, 354
Eco32I GATATC 1 cut(s) 240
Eco47I GGWCC 1 cut(s) 94
EcoRII CCWGG 1 cut(s) 286
EcoRV GATATC 1 cut(s) 240
Esp3I CGTCTC 1 cut(s) 465
FaeI CATG 3 cut(s) 120, 312, 435
FatI CATG 3 cut(s) 116, 308, 431
Fnu4HI GCNGC 4 cut(s) 73, 354, 501, 513
Fsp4HI GCNGC 4 cut(s) 73, 354, 501, 513
GluI GCNGC 4 cut(s) 73, 354, 501, 513
GsuI CTGGAG 1 cut(s) 309
HaeIII GGCC 2 cut(s) 209, 356
HapII CCGG 2 cut(s) 232, 350
Hin1II CATG 3 cut(s) 120, 312, 435
HincII GTYRAC 1 cut(s) 303
HindII GTYRAC 1 cut(s) 303
HinfI GANTC 2 cut(s) 4, 440
HpaI GTTAAC 1 cut(s) 303
HpaII CCGG 2 cut(s) 232, 350
Hpy166II GTNNAC 1 cut(s) 303
Hpy188I TCNGA 2 cut(s) 255, 449
Hpy188III TCNNGA 1 cut(s) 184
Hpy8I GTNNAC 1 cut(s) 303
Hpy99I CGWCG 1 cut(s) 215
HpyAV CCTTC 1 cut(s) 65
HpyCH4III ACNGT 1 cut(s) 300
HpyCH4IV ACGT 1 cut(s) 213
HpyCH4V TGCA 6 cut(s) 72, 120, 191, 425, 500, 512
HpyF10VI GCNNNNNNNGC 2 cut(s) 72, 509
HpySE526I ACGT 1 cut(s) 213
Hsp92II CATG 3 cut(s) 120, 312, 435
KspAI GTTAAC 1 cut(s) 303
Kzo9I GATC 4 cut(s) 139, 180, 330, 379
LpnPI CCDG 7 cut(s) 144, 181, 245, 273, 300, 363, 378
Lsp1109I GCAGC 3 cut(s) 84, 512, 524
MaeII ACGT 1 cut(s) 213
MaeIII GTNAC 1 cut(s) 407
MalI GATC 4 cut(s) 141, 182, 332, 381
MboI GATC 4 cut(s) 139, 180, 330, 379
MboII GAAGA 1 cut(s) 373
MfeI CAATTG 1 cut(s) 527
MflI RGATCY 1 cut(s) 180
MluCI AATT 4 cut(s) 261, 366, 402, 527
MnlI CCTC 4 cut(s) 103, 430, 443, 474
MseI TTAA 2 cut(s) 159, 302
MspI CCGG 2 cut(s) 232, 350
MspR9I CCNGG 2 cut(s) 288, 350
MunI CAATTG 1 cut(s) 527
MvaI CCWGG 1 cut(s) 288
MwoI GCNNNNNNNGC 2 cut(s) 72, 509
NciI CCSGG 1 cut(s) 350
NdeII GATC 4 cut(s) 139, 180, 330, 379
NlaIII CATG 3 cut(s) 120, 312, 435
NmuCI GTSAC 1 cut(s) 407
NspI RCATGY 2 cut(s) 120, 312
PciI ACATGT 1 cut(s) 308
PfeI GAWTC 2 cut(s) 4, 440
PkrI GCNGC 4 cut(s) 74, 355, 502, 514
Ple19I CGATCG 1 cut(s) 333
PscI ACATGT 1 cut(s) 308
Psp6I CCWGG 1 cut(s) 286
PspGI CCWGG 1 cut(s) 286
PspPI GGNCC 1 cut(s) 94
PstI CTGCAG 1 cut(s) 514
PsuI RGATCY 1 cut(s) 180
PvuI CGATCG 1 cut(s) 333
SaqAI TTAA 2 cut(s) 159, 302
SatI GCNGC 4 cut(s) 73, 354, 501, 513
Sau3AI GATC 4 cut(s) 139, 180, 330, 379
Sau96I GGNCC 1 cut(s) 94
ScrFI CCNGG 2 cut(s) 288, 350
SetI ASST 6 cut(s) 216, 273, 289, 390, 498, 505
SfcI CTRYAG 1 cut(s) 510
SinI GGWCC 1 cut(s) 94
Sse9I AATT 4 cut(s) 261, 366, 402, 527
SsiI CCGC 1 cut(s) 353
StyD4I CCNGG 2 cut(s) 286, 348
TaaI ACNGT 1 cut(s) 300
TaiI ACGT 1 cut(s) 216
TaqI TCGA 1 cut(s) 164
TasI AATT 4 cut(s) 261, 366, 402, 527
TauI GCSGC 1 cut(s) 356
TfiI GAWTC 2 cut(s) 4, 440
Tru1I TTAA 2 cut(s) 159, 302
Tru9I TTAA 2 cut(s) 159, 302
TscAI CASTG 1 cut(s) 175
TseFI GTSAC 1 cut(s) 407
TseI GCWGC 3 cut(s) 72, 500, 512
Tsp45I GTSAC 1 cut(s) 407
TspDTI ATGAA 2 cut(s) 17, 432
TspGWI ACGGA 1 cut(s) 447
TspRI CASTG 1 cut(s) 175
VpaK11BI GGWCC 1 cut(s) 94
XceI RCATGY 2 cut(s) 120, 312
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.