Rroxscaffold_3G00234970

Cell wall vacuolar inhibitor of fructosidase 1-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0016266
Physical Location & Seq
Forward (+)
21681521 .. 21683416
1896 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00234970.1

Sequence Viewer

Length: 489 bp
ATGGACGAAAATCTTATTGAGGAAACATGCAGAAAGACACCAGACTACGATATATGTCTCTTTTGTCTTAAATCGACCGGTGGTAGTGAGATCTTGACTGCAAATCGCACACGCTTGGCCGATGTAATGATTGATGTAGTCGGGCAGAGATCGACCACCACTATGAACAAAATGAGTGACCTTCTTGGTAAAACACCTGGAGATACATATCAACCGTTATCTACATGTATTCTAAAGTACATTACGATCGTAAGTCGTGATATCCCGACGGCCAAGAAGACAATTTATACGAGTGATCGTACGGTGGCAAAGAAAATAATGGATAACATTACAAATGTTGCAAAATCATGTGGGGATTCATTCAGAGGCAAGCTGCCTCCTATTACTGACTTGAATATAGCTGTCCAAAATGTTGCAGCTATTGCTACAGCAATAATAGGGCAATTGGATACAATGAAAAAACATAACTATGAGGAAGATTACCGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PMEI

Protein Analysis

162

Amino Acids

17.98

Weight (kDa)

7.57

Isoelectric Point (pI)

39.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PMEI PF04043 4 - 145 1.8e-11 Plant invertase/pectin methylesterase inhibitor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 2 cut(s) 117, 270
AfaI GTAC 2 cut(s) 239, 301
AflIII ACRYGT 1 cut(s) 224
AgeI ACCGGT 2 cut(s) 77, 483
AgsI TTSAA 1 cut(s) 394
AjnI CCWGG 1 cut(s) 196
AluBI AGCT 3 cut(s) 373, 401, 419
AluI AGCT 3 cut(s) 373, 401, 419
Alw26I GTCTC 1 cut(s) 62
AoxI GGCC 2 cut(s) 117, 270
ApeKI GCWGC 2 cut(s) 373, 416
AsiGI ACCGGT 2 cut(s) 77, 483
BbsI GAAGAC 1 cut(s) 284
BbvI GCAGC 2 cut(s) 360, 428
BceAI ACGGC 1 cut(s) 285
BciT130I CCWGG 1 cut(s) 198
BciVI GTATCC 1 cut(s) 442
BcoDI GTCTC 1 cut(s) 62
BfmI CTRYAG 1 cut(s) 426
BfuI GTATCC 1 cut(s) 442
BglII AGATCT 1 cut(s) 90
BisI GCNGC 2 cut(s) 374, 417
BlsI GCNGC 2 cut(s) 375, 418
Bme1390I CCNGG 1 cut(s) 198
BmrFI CCNGG 1 cut(s) 198
BpiI GAAGAC 1 cut(s) 284
BpmI CTGGAG 1 cut(s) 219
BsaBI GATNNNNATC 1 cut(s) 207
BsaWI WCCGGW 2 cut(s) 77, 483
Bse118I RCCGGY 2 cut(s) 77, 483
Bse8I GATNNNNATC 1 cut(s) 207
BseBI CCWGG 1 cut(s) 198
BseJI GATNNNNATC 1 cut(s) 207
BseXI GCAGC 2 cut(s) 360, 428
Bsh1285I CGRYCG 2 cut(s) 78, 249
BshFI GGCC 2 cut(s) 119, 272
BshTI ACCGGT 2 cut(s) 77, 483
BsiEI CGRYCG 2 cut(s) 78, 249
BsiSI CCGG 2 cut(s) 78, 484
BsiWI CGTACG 1 cut(s) 299
BsmAI GTCTC 1 cut(s) 62
BsnI GGCC 2 cut(s) 119, 272
Bsp143I GATC 4 cut(s) 90, 149, 246, 295
BspANI GGCC 2 cut(s) 119, 272
BsrFI RCCGGY 2 cut(s) 77, 483
BssAI RCCGGY 2 cut(s) 77, 483
BssMI GATC 4 cut(s) 90, 149, 246, 295
Bst2UI CCWGG 1 cut(s) 198
Bst4CI ACNGT 2 cut(s) 216, 304
BstAPI GCANNNNNTGC 1 cut(s) 422
BstC8I GCNNGC 1 cut(s) 371
BstKTI GATC 4 cut(s) 93, 152, 249, 298
BstMAI GTCTC 1 cut(s) 62
BstMBI GATC 4 cut(s) 90, 149, 246, 295
BstMCI CGRYCG 2 cut(s) 78, 249
BstMWI GCNNNNNNNGC 1 cut(s) 422
BstNI CCWGG 1 cut(s) 198
BstNSI RCATGY 2 cut(s) 30, 228
BstSCI CCNGG 1 cut(s) 196
BstSFI CTRYAG 1 cut(s) 426
BstV1I GCAGC 2 cut(s) 360, 428
BstV2I GAAGAC 1 cut(s) 284
BstX2I RGATCY 1 cut(s) 90
BstYI RGATCY 1 cut(s) 90
BsuI GTATCC 1 cut(s) 442
BsuRI GGCC 2 cut(s) 119, 272
Cac8I GCNNGC 1 cut(s) 371
Cfr10I RCCGGY 2 cut(s) 77, 483
Csp6I GTAC 2 cut(s) 238, 300
CspAI ACCGGT 2 cut(s) 77, 483
CviAII CATG 3 cut(s) 27, 225, 348
CviJI RGCY 5 cut(s) 119, 272, 373, 401, 419
CviKI_1 RGCY 5 cut(s) 119, 272, 373, 401, 419
CviQI GTAC 2 cut(s) 238, 300
DpnI GATC 4 cut(s) 92, 151, 248, 297
DpnII GATC 4 cut(s) 90, 149, 246, 295
EaeI YGGCCR 2 cut(s) 117, 270
Eco32I GATATC 1 cut(s) 262
EcoRII CCWGG 1 cut(s) 196
EcoRV GATATC 1 cut(s) 262
FaeI CATG 3 cut(s) 30, 228, 351
FatI CATG 3 cut(s) 26, 224, 347
Fnu4HI GCNGC 2 cut(s) 374, 417
Fsp4HI GCNGC 2 cut(s) 374, 417
GluI GCNGC 2 cut(s) 374, 417
GsuI CTGGAG 1 cut(s) 219
HaeIII GGCC 2 cut(s) 119, 272
HapII CCGG 2 cut(s) 78, 484
Hin1II CATG 3 cut(s) 30, 228, 351
HinfI GANTC 1 cut(s) 356
HpaII CCGG 2 cut(s) 78, 484
Hpy188I TCNGA 1 cut(s) 365
Hpy188III TCNNGA 3 cut(s) 94, 257, 265
Hpy99I CGWCG 1 cut(s) 271
HpyAV CCTTC 1 cut(s) 191
HpyCH4III ACNGT 2 cut(s) 216, 304
HpyCH4V TGCA 4 cut(s) 30, 101, 341, 416
HpyF10VI GCNNNNNNNGC 1 cut(s) 422
Hsp92II CATG 3 cut(s) 30, 228, 351
Kzo9I GATC 4 cut(s) 90, 149, 246, 295
LpnPI CCDG 4 cut(s) 54, 91, 183, 210
Lsp1109I GCAGC 2 cut(s) 360, 428
MaeIII GTNAC 1 cut(s) 176
MalI GATC 4 cut(s) 92, 151, 248, 297
MboI GATC 4 cut(s) 90, 149, 246, 295
MboII GAAGA 2 cut(s) 289, 488
MfeI CAATTG 1 cut(s) 443
MflI RGATCY 1 cut(s) 90
MluCI AATT 2 cut(s) 282, 443
MnlI CCTC 4 cut(s) 13, 359, 387, 466
MseI TTAA 1 cut(s) 69
MslI CAYNNNNRTG 2 cut(s) 161, 468
MspI CCGG 2 cut(s) 78, 484
MspR9I CCNGG 1 cut(s) 198
MunI CAATTG 1 cut(s) 443
MvaI CCWGG 1 cut(s) 198
MwoI GCNNNNNNNGC 1 cut(s) 422
NdeII GATC 4 cut(s) 90, 149, 246, 295
NlaIII CATG 3 cut(s) 30, 228, 351
NmuCI GTSAC 1 cut(s) 176
NspI RCATGY 2 cut(s) 30, 228
PciI ACATGT 1 cut(s) 224
PfeI GAWTC 1 cut(s) 356
Pfl23II CGTACG 1 cut(s) 299
PinAI ACCGGT 2 cut(s) 77, 483
PkrI GCNGC 2 cut(s) 375, 418
Ple19I CGATCG 1 cut(s) 249
PscI ACATGT 1 cut(s) 224
Psp6I CCWGG 1 cut(s) 196
PspGI CCWGG 1 cut(s) 196
PspLI CGTACG 1 cut(s) 299
PsuI RGATCY 1 cut(s) 90
PvuI CGATCG 1 cut(s) 249
RsaI GTAC 2 cut(s) 239, 301
RsaNI GTAC 2 cut(s) 238, 300
RseI CAYNNNNRTG 2 cut(s) 161, 468
SaqAI TTAA 1 cut(s) 69
SatI GCNGC 2 cut(s) 374, 417
Sau3AI GATC 4 cut(s) 90, 149, 246, 295
ScrFI CCNGG 1 cut(s) 198
SetI ASST 5 cut(s) 183, 199, 375, 403, 421
SfcI CTRYAG 1 cut(s) 426
SmiMI CAYNNNNRTG 2 cut(s) 161, 468
Sse9I AATT 2 cut(s) 282, 443
StyD4I CCNGG 1 cut(s) 196
TaaI ACNGT 2 cut(s) 216, 304
TaqI TCGA 2 cut(s) 74, 152
TasI AATT 2 cut(s) 282, 443
TatI WGTACW 1 cut(s) 237
TfiI GAWTC 1 cut(s) 356
Tru1I TTAA 1 cut(s) 69
Tru9I TTAA 1 cut(s) 69
TseFI GTSAC 1 cut(s) 176
TseI GCWGC 2 cut(s) 373, 416
Tsp45I GTSAC 1 cut(s) 176
TspDTI ATGAA 3 cut(s) 179, 348, 470
XceI RCATGY 2 cut(s) 30, 228
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.