FvH4_2g24930

May serve as docking site to facilitate the association of other proteins to the plasma membrane

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
OG0013616
Physical Location & Seq
Reverse (-)
20259937 .. 20260933
997 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g24930.t1

Sequence Viewer

Length: 492 bp
ATGAGGTGCTTGCTTGGCTGGATTGGTTCTGATTCTGCTGATTCAGATGTAAACCCTTTGTTTGTTGCTCTTGATCGATTTGGTGAATTTGCTGAGGTGGAATTTTTGAGTGGGAATTGTGTGATTGGAGGAGGAGGGAGAGAGGAGCGGATTGAGCTTAAGTTCAGGATTTATGATGGAACAGACATTGCGCACAGTTGTTATGCACCTTCCATGACTGTAGCTACTCTTAAGAAAAGGTTGCTTTCTGAGTGGCCTCAAGCCAAGACAGTGACACCCAAGACAGTGAGTGAAGTGAAACTGATACATGGTGGGAAAGTTTTAGAGAACAGTAAGACACTTGCTGATTCCAGAATAATGTCCTTTGGTAACTTGCCTGGTGGTGTTATAACCATGCATGTGGTAGTACAGCCCACTATTGCCAAAGAGAAGAAAGCTAAAAACCAGAAGGAGATGCAAAAGATGAATTCATGCTCGTGTACCATTCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Rad60-SLD_2

Protein Analysis

164

Amino Acids

17.86

Weight (kDa)

8.6

Isoelectric Point (pI)

45.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD_2 PF13881 49 - 161 1.2e-35 Ubiquitin-2 like Rad60 SUMO-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 389
Acc16I TGCGCA 1 cut(s) 192
AccBSI CCGCTC 1 cut(s) 148
AciI CCGC 1 cut(s) 148
AcsI RAATTY 3 cut(s) 86, 101, 466
AfaI GTAC 2 cut(s) 408, 481
AflII CTTAAG 2 cut(s) 158, 230
AjnI CCWGG 1 cut(s) 376
AluBI AGCT 3 cut(s) 157, 224, 437
AluI AGCT 3 cut(s) 157, 224, 437
AoxI GGCC 1 cut(s) 254
ApoI RAATTY 3 cut(s) 86, 101, 466
AspLEI GCGC 1 cut(s) 193
AsuHPI GGTGA 1 cut(s) 95
BauI CACGAG 1 cut(s) 475
BbvCI CCTCAGC 1 cut(s) 93
BccI CCATC 1 cut(s) 170
BciT130I CCWGG 1 cut(s) 378
BfmI CTRYAG 1 cut(s) 219
BfrI CTTAAG 2 cut(s) 158, 230
Bme1390I CCNGG 1 cut(s) 378
BmrFI CCNGG 1 cut(s) 378
BmsI GCATC 1 cut(s) 444
Bpu10I CCTNAGC 1 cut(s) 93
BpuEI CTTGAG 1 cut(s) 243
Bsa29I ATCGAT 1 cut(s) 76
Bse3DI GCAATG 1 cut(s) 186
BseBI CCWGG 1 cut(s) 378
BseCI ATCGAT 1 cut(s) 76
BseMI GCAATG 1 cut(s) 186
BseMII CTCAG 2 cut(s) 84, 240
BseRI GAGGAG 3 cut(s) 144, 147, 158
BshFI GGCC 1 cut(s) 256
BshVI ATCGAT 1 cut(s) 76
BsnI GGCC 1 cut(s) 256
Bsp143I GATC 1 cut(s) 73
BspACI CCGC 1 cut(s) 148
BspANI GGCC 1 cut(s) 256
BspCNI CTCAG 2 cut(s) 85, 241
BspDI ATCGAT 1 cut(s) 76
BspTI CTTAAG 2 cut(s) 158, 230
BsrBI CCGCTC 1 cut(s) 148
BsrDI GCAATG 1 cut(s) 186
BssMI GATC 1 cut(s) 73
BssSI CACGAG 1 cut(s) 475
Bst2BI CACGAG 1 cut(s) 475
Bst2UI CCWGG 1 cut(s) 378
Bst4CI ACNGT 5 cut(s) 197, 220, 271, 286, 332
BstAFI CTTAAG 2 cut(s) 158, 230
BstC8I GCNNGC 1 cut(s) 11
BstDEI CTNAG 2 cut(s) 93, 249
BstHHI GCGC 1 cut(s) 193
BstKTI GATC 1 cut(s) 76
BstMBI GATC 1 cut(s) 73
BstMWI GCNNNNNNNGC 2 cut(s) 15, 154
BstNI CCWGG 1 cut(s) 378
BstNSI RCATGY 1 cut(s) 401
BstSCI CCNGG 1 cut(s) 376
BstSFI CTRYAG 1 cut(s) 219
BstXI CCANNNNNNTGG 1 cut(s) 400
Bsu15I ATCGAT 1 cut(s) 76
BsuRI GGCC 1 cut(s) 256
BsuTUI ATCGAT 1 cut(s) 76
BtsIMutI CAGTG 2 cut(s) 276, 291
Cac8I GCNNGC 1 cut(s) 11
CfoI GCGC 1 cut(s) 193
ClaI ATCGAT 1 cut(s) 76
Csp6I GTAC 2 cut(s) 407, 480
CviAII CATG 5 cut(s) 214, 308, 394, 398, 471
CviJI RGCY 7 cut(s) 18, 157, 224, 256, 263, 412, 437
CviKI_1 RGCY 7 cut(s) 18, 157, 224, 256, 263, 412, 437
CviQI GTAC 2 cut(s) 407, 480
DdeI CTNAG 2 cut(s) 93, 249
DpnI GATC 1 cut(s) 75
DpnII GATC 1 cut(s) 73
EcoRI GAATTC 1 cut(s) 466
EcoRII CCWGG 1 cut(s) 376
EcoT22I ATGCAT 1 cut(s) 399
FaeI CATG 5 cut(s) 217, 311, 397, 401, 474
FaiI YATR 8 cut(s) 174, 204, 215, 309, 389, 395, 399, 472
FatI CATG 5 cut(s) 213, 307, 393, 397, 470
FspI TGCGCA 1 cut(s) 192
GlaI GCGC 1 cut(s) 192
HaeIII GGCC 1 cut(s) 256
HhaI GCGC 1 cut(s) 193
Hin1II CATG 5 cut(s) 217, 311, 397, 401, 474
Hin6I GCGC 1 cut(s) 191
HinP1I GCGC 1 cut(s) 191
HinfI GANTC 3 cut(s) 32, 41, 347
HphI GGTGA 1 cut(s) 95
Hpy166II GTNNAC 2 cut(s) 52, 480
Hpy188I TCNGA 3 cut(s) 31, 46, 250
Hpy188III TCNNGA 3 cut(s) 71, 166, 351
Hpy8I GTNNAC 2 cut(s) 52, 480
HpyAV CCTTC 2 cut(s) 219, 442
HpyCH4III ACNGT 5 cut(s) 197, 220, 271, 286, 332
HpyCH4V TGCA 3 cut(s) 206, 397, 457
HpyF10VI GCNNNNNNNGC 2 cut(s) 15, 154
HpyF3I CTNAG 2 cut(s) 93, 249
Hsp92II CATG 5 cut(s) 217, 311, 397, 401, 474
HspAI GCGC 1 cut(s) 191
Kzo9I GATC 1 cut(s) 73
LmnI GCTCC 1 cut(s) 145
LpnPI CCDG 6 cut(s) 4, 151, 363, 364, 390, 458
LweI GCATC 1 cut(s) 444
MaeIII GTNAC 2 cut(s) 271, 368
MalI GATC 1 cut(s) 75
MbiI CCGCTC 1 cut(s) 148
MboI GATC 1 cut(s) 73
MboII GAAGA 1 cut(s) 442
MluCI AATT 4 cut(s) 86, 101, 115, 466
MnlI CCTC 6 cut(s) 88, 122, 125, 128, 136, 267
Mph1103I ATGCAT 1 cut(s) 399
MseI TTAA 3 cut(s) 159, 231, 490
MslI CAYNNNNRTG 2 cut(s) 398, 475
MspCI CTTAAG 2 cut(s) 158, 230
MspR9I CCNGG 1 cut(s) 378
MvaI CCWGG 1 cut(s) 378
MwoI GCNNNNNNNGC 2 cut(s) 15, 154
NdeII GATC 1 cut(s) 73
NlaIII CATG 5 cut(s) 217, 311, 397, 401, 474
NmuCI GTSAC 1 cut(s) 271
NsbI TGCGCA 1 cut(s) 192
NsiI ATGCAT 1 cut(s) 399
NspI RCATGY 1 cut(s) 401
PfeI GAWTC 3 cut(s) 32, 41, 347
PsiI TTATAA 1 cut(s) 389
Psp6I CCWGG 1 cut(s) 376
PspGI CCWGG 1 cut(s) 376
RsaI GTAC 2 cut(s) 408, 481
RsaNI GTAC 2 cut(s) 407, 480
RseI CAYNNNNRTG 2 cut(s) 398, 475
SaqAI TTAA 3 cut(s) 159, 231, 490
Sau3AI GATC 1 cut(s) 73
ScrFI CCNGG 1 cut(s) 378
SetI ASST 7 cut(s) 8, 99, 159, 211, 226, 242, 439
SfaNI GCATC 1 cut(s) 444
SfcI CTRYAG 1 cut(s) 219
SmiMI CAYNNNNRTG 2 cut(s) 398, 475
SmlI CTYRAG 3 cut(s) 158, 230, 258
SmoI CTYRAG 3 cut(s) 158, 230, 258
Sse9I AATT 4 cut(s) 86, 101, 115, 466
SsiI CCGC 1 cut(s) 148
StyD4I CCNGG 1 cut(s) 376
TaaI ACNGT 5 cut(s) 197, 220, 271, 286, 332
TaqI TCGA 1 cut(s) 76
TasI AATT 4 cut(s) 86, 101, 115, 466
TatI WGTACW 1 cut(s) 406
TfiI GAWTC 3 cut(s) 32, 41, 347
Tru1I TTAA 3 cut(s) 159, 231, 490
Tru9I TTAA 3 cut(s) 159, 231, 490
TscAI CASTG 2 cut(s) 276, 291
TseFI GTSAC 1 cut(s) 271
Tsp45I GTSAC 1 cut(s) 271
TspDTI ATGAA 2 cut(s) 459, 479
TspRI CASTG 2 cut(s) 276, 291
Vha464I CTTAAG 2 cut(s) 158, 230
XapI RAATTY 3 cut(s) 86, 101, 466
XceI RCATGY 1 cut(s) 401
Zsp2I ATGCAT 1 cut(s) 399
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.