Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000639.1

Orthogroup ID

OG0013616

Physical Location & Seq

Genomic Coordinates Forward (+)

117630 .. 118704

Gene Structure 1075 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000639.1_g000020.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 489 bp

atgaggtgcttacttggctggattggttctgattctgctgattcagatgtaaagcctttgattgttcttgatcgatttcgtgaattcgctgaggtgggttgggggagattggatttttttagtgggaattgtgtgagagaggagcgcattgagcttaagttcaggatttatgatggaacagatattgggcacagttcttatgcgccttccatgactgtagctactcttaagaaaaggctactttctgagtggcctcaagccaaaacagtgacacccaagacagtgaatgaagtgaaactgatacatggtgggagagttttagagaatagtaagacacttgctgattccaaaataatgtcctttggtaacttacctggtggtgttataaccatgcatgtggtagttcagcctactgttgctaaagagaaaaaagctaaaaaccagaaggatatgcaaaagatgaattcatgctcgtgtaccattctttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Rad60-SLD_2

Protein Analysis

162

Amino Acids

18.09

Weight (kDa)

9.23

Isoelectric Point (pI)

39.51

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013616)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g24930
malus_domestica	MD03G1277800.v1.1 MD11G1299700.v1.1
prunus_persica	Prupe.8G254100_v2.0.a1 Prupe.8G254100_v2.0.a1 Prupe.8G254100_v2.0.a1
pyrus_communis	pycom03g22120 pycom11g26340
rosa_chinensis	RchiOBHm_Chr6g0292851
rosa_laevigata	RLG00000011987
rosa_multiflora	Rmu_sc0000639.1_g000020
rosa_roxburghii	Rroxscaffold_7G00174650
rosa_rugosa	Rorug06G0230200
rosa_samantha	Rh6AG343500 Rh6BG350700 Rh6CG357700 Rh6DG343600
rosa_wichuraiana	Rw6G029960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	386
AcsI	RAATTY	2 cut(s)	83, 463
AfaI	GTAC	1 cut(s)	478
AflII	CTTAAG	2 cut(s)	155, 227
AjnI	CCWGG	1 cut(s)	373
AluBI	AGCT	3 cut(s)	154, 221, 434
AluI	AGCT	3 cut(s)	154, 221, 434
AoxI	GGCC	1 cut(s)	251
ApoI	RAATTY	2 cut(s)	83, 463
AspLEI	GCGC	2 cut(s)	147, 205
BaeGI	GKGCMC	1 cut(s)	192
BauI	CACGAG	1 cut(s)	472
BbvCI	CCTCAGC	1 cut(s)	90
BccI	CCATC	1 cut(s)	167
BciT130I	CCWGG	1 cut(s)	375
BfmI	CTRYAG	1 cut(s)	216
BfrI	CTTAAG	2 cut(s)	155, 227
Bme1390I	CCNGG	1 cut(s)	375
BmrFI	CCNGG	1 cut(s)	375
Bpu10I	CCTNAGC	1 cut(s)	90
BpuEI	CTTGAG	1 cut(s)	240
Bsa29I	ATCGAT	1 cut(s)	73
BseBI	CCWGG	1 cut(s)	375
BseCI	ATCGAT	1 cut(s)	73
BseMII	CTCAG	2 cut(s)	81, 237
BseRI	GAGGAG	1 cut(s)	155
BseSI	GKGCMC	1 cut(s)	192
BshFI	GGCC	1 cut(s)	253
BshVI	ATCGAT	1 cut(s)	73
BsnI	GGCC	1 cut(s)	253
Bsp1286I	GDGCHC	1 cut(s)	192
Bsp143I	GATC	1 cut(s)	70
BspANI	GGCC	1 cut(s)	253
BspCNI	CTCAG	2 cut(s)	82, 238
BspDI	ATCGAT	1 cut(s)	73
BspTI	CTTAAG	2 cut(s)	155, 227
BssMI	GATC	1 cut(s)	70
BssSI	CACGAG	1 cut(s)	472
Bst2BI	CACGAG	1 cut(s)	472
Bst2UI	CCWGG	1 cut(s)	375
Bst4CI	ACNGT	5 cut(s)	194, 217, 268, 283, 415
BstAFI	CTTAAG	2 cut(s)	155, 227
BstDEI	CTNAG	2 cut(s)	90, 246
BstHHI	GCGC	2 cut(s)	147, 205
BstKTI	GATC	1 cut(s)	73
BstMBI	GATC	1 cut(s)	70
BstMWI	GCNNNNNNNGC	2 cut(s)	15, 151
BstNI	CCWGG	1 cut(s)	375
BstNSI	RCATGY	1 cut(s)	398
BstSCI	CCNGG	1 cut(s)	373
BstSFI	CTRYAG	1 cut(s)	216
BstSLI	GKGCMC	1 cut(s)	192
BstXI	CCANNNNNNTGG	1 cut(s)	397
Bsu15I	ATCGAT	1 cut(s)	73
BsuRI	GGCC	1 cut(s)	253
BsuTUI	ATCGAT	1 cut(s)	73
BtsIMutI	CAGTG	2 cut(s)	273, 288
CfoI	GCGC	2 cut(s)	147, 205
ClaI	ATCGAT	1 cut(s)	73
CsiI	ACCWGGT	1 cut(s)	373
Csp6I	GTAC	1 cut(s)	477
CviAII	CATG	5 cut(s)	211, 305, 391, 395, 468
CviJI	RGCY	9 cut(s)	18, 55, 154, 221, 238, 253, 260, 409, 434
CviKI_1	RGCY	9 cut(s)	18, 55, 154, 221, 238, 253, 260, 409, 434
CviQI	GTAC	1 cut(s)	477
DdeI	CTNAG	2 cut(s)	90, 246
DpnI	GATC	1 cut(s)	72
DpnII	GATC	1 cut(s)	70
EcoRI	GAATTC	2 cut(s)	83, 463
EcoRII	CCWGG	1 cut(s)	373
EcoT22I	ATGCAT	1 cut(s)	396
FaeI	CATG	5 cut(s)	214, 308, 394, 398, 471
FaiI	YATR	9 cut(s)	171, 201, 212, 306, 386, 392, 396, 452, 469
FatI	CATG	5 cut(s)	210, 304, 390, 394, 467
GlaI	GCGC	2 cut(s)	146, 204
HaeIII	GGCC	1 cut(s)	253
HhaI	GCGC	2 cut(s)	147, 205
Hin1II	CATG	5 cut(s)	214, 308, 394, 398, 471
Hin6I	GCGC	2 cut(s)	145, 203
HinP1I	GCGC	2 cut(s)	145, 203
HinfI	GANTC	3 cut(s)	32, 41, 344
Hpy166II	GTNNAC	1 cut(s)	477
Hpy188I	TCNGA	3 cut(s)	31, 46, 247
Hpy188III	TCNNGA	3 cut(s)	68, 80, 163
Hpy8I	GTNNAC	1 cut(s)	477
HpyAV	CCTTC	2 cut(s)	216, 439
HpyCH4III	ACNGT	5 cut(s)	194, 217, 268, 283, 415
HpyCH4V	TGCA	2 cut(s)	394, 454
HpyF10VI	GCNNNNNNNGC	2 cut(s)	15, 151
HpyF3I	CTNAG	2 cut(s)	90, 246
Hsp92II	CATG	5 cut(s)	214, 308, 394, 398, 471
HspAI	GCGC	2 cut(s)	145, 203
Kzo9I	GATC	1 cut(s)	70
LmnI	GCTCC	1 cut(s)	142
LpnPI	CCDG	5 cut(s)	4, 148, 360, 387, 455
MabI	ACCWGGT	1 cut(s)	373
MaeIII	GTNAC	2 cut(s)	268, 365
MalI	GATC	1 cut(s)	72
MboI	GATC	1 cut(s)	70
MhlI	GDGCHC	1 cut(s)	192
MluCI	AATT	3 cut(s)	83, 127, 463
MnlI	CCTC	3 cut(s)	85, 133, 264
Mph1103I	ATGCAT	1 cut(s)	396
MseI	TTAA	3 cut(s)	156, 228, 487
MslI	CAYNNNNRTG	2 cut(s)	395, 472
MspCI	CTTAAG	2 cut(s)	155, 227
MspR9I	CCNGG	1 cut(s)	375
MvaI	CCWGG	1 cut(s)	375
MwoI	GCNNNNNNNGC	2 cut(s)	15, 151
NdeII	GATC	1 cut(s)	70
NlaIII	CATG	5 cut(s)	214, 308, 394, 398, 471
NmuCI	GTSAC	1 cut(s)	268
NsiI	ATGCAT	1 cut(s)	396
NspI	RCATGY	1 cut(s)	398
PfeI	GAWTC	3 cut(s)	32, 41, 344
PsiI	TTATAA	1 cut(s)	386
Psp6I	CCWGG	1 cut(s)	373
PspGI	CCWGG	1 cut(s)	373
RsaI	GTAC	1 cut(s)	478
RsaNI	GTAC	1 cut(s)	477
RseI	CAYNNNNRTG	2 cut(s)	395, 472
SaqAI	TTAA	3 cut(s)	156, 228, 487
Sau3AI	GATC	1 cut(s)	70
ScrFI	CCNGG	1 cut(s)	375
SduI	GDGCHC	1 cut(s)	192
SetI	ASST	6 cut(s)	8, 96, 156, 223, 376, 436
SexAI	ACCWGGT	1 cut(s)	373
SfcI	CTRYAG	1 cut(s)	216
SmiMI	CAYNNNNRTG	2 cut(s)	395, 472
SmlI	CTYRAG	3 cut(s)	155, 227, 255
SmoI	CTYRAG	3 cut(s)	155, 227, 255
Sse9I	AATT	3 cut(s)	83, 127, 463
StyD4I	CCNGG	1 cut(s)	373
TaaI	ACNGT	5 cut(s)	194, 217, 268, 283, 415
TaqI	TCGA	1 cut(s)	73
TasI	AATT	3 cut(s)	83, 127, 463
TfiI	GAWTC	3 cut(s)	32, 41, 344
Tru1I	TTAA	3 cut(s)	156, 228, 487
Tru9I	TTAA	3 cut(s)	156, 228, 487
TscAI	CASTG	2 cut(s)	273, 288
TseFI	GTSAC	1 cut(s)	268
Tsp45I	GTSAC	1 cut(s)	268
TspDTI	ATGAA	3 cut(s)	303, 456, 476
TspRI	CASTG	2 cut(s)	273, 288
Vha464I	CTTAAG	2 cut(s)	155, 227
XapI	RAATTY	2 cut(s)	83, 463
XceI	RCATGY	1 cut(s)	398
Zsp2I	ATGCAT	1 cut(s)	396

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.