Rh6BG350700

May serve as docking site to facilitate the association of other proteins to the plasma membrane

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
58142654 .. 58145080
2427 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG350700.1

Sequence Viewer

Length: 312 bp
ATGTCTCAGAGAGAGGAGCGCATTGAGCTTAAGTTCAGGATTTATGATGGAACAGATATTGGGCACAGTTCTTATGCGCCTTCCATGACTGTAGCTACTCTTAAGAAAAGGCTACTTTCTGAGTGGCCTCAAGCCAAAACAGTGACACCCAAGACAGTGAATGAAGTGAAACTGATACATGGTGGGAGAGTTTTAGAGAATAGTAAGACACTTGCTGATTCCAAAATAATGTCCTTTGGTAACTTACCTGGTGGTGTTATAACCATGCATGTGGTAGTTCAGCCTACTGTTGCTAAAGAGAAGAAAGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

11.41

Weight (kDa)

9.79

Isoelectric Point (pI)

49.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD_2 PF13881 6 - 102 2.6e-33 Ubiquitin-2 like Rad60 SUMO-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 260
AflII CTTAAG 2 cut(s) 29, 101
AjnI CCWGG 1 cut(s) 247
AluBI AGCT 2 cut(s) 28, 95
AluI AGCT 2 cut(s) 28, 95
Alw26I GTCTC 1 cut(s) 9
AoxI GGCC 1 cut(s) 125
AspLEI GCGC 2 cut(s) 21, 79
BaeGI GKGCMC 1 cut(s) 66
BccI CCATC 1 cut(s) 41
BciT130I CCWGG 1 cut(s) 249
BcoDI GTCTC 1 cut(s) 9
BfmI CTRYAG 1 cut(s) 90
BfrI CTTAAG 2 cut(s) 29, 101
Bme1390I CCNGG 1 cut(s) 249
BmrFI CCNGG 1 cut(s) 249
BpuEI CTTGAG 1 cut(s) 114
BseBI CCWGG 1 cut(s) 249
BseMII CTCAG 2 cut(s) 20, 111
BseRI GAGGAG 1 cut(s) 29
BseSI GKGCMC 1 cut(s) 66
BshFI GGCC 1 cut(s) 127
BsmAI GTCTC 1 cut(s) 9
BsnI GGCC 1 cut(s) 127
Bsp1286I GDGCHC 1 cut(s) 66
BspANI GGCC 1 cut(s) 127
BspCNI CTCAG 2 cut(s) 19, 112
BspTI CTTAAG 2 cut(s) 29, 101
Bst2UI CCWGG 1 cut(s) 249
Bst4CI ACNGT 5 cut(s) 68, 91, 142, 157, 289
BstAFI CTTAAG 2 cut(s) 29, 101
BstDEI CTNAG 2 cut(s) 6, 120
BstHHI GCGC 2 cut(s) 21, 79
BstMAI GTCTC 1 cut(s) 9
BstMWI GCNNNNNNNGC 1 cut(s) 25
BstNI CCWGG 1 cut(s) 249
BstNSI RCATGY 1 cut(s) 272
BstSCI CCNGG 1 cut(s) 247
BstSFI CTRYAG 1 cut(s) 90
BstSLI GKGCMC 1 cut(s) 66
BstXI CCANNNNNNTGG 1 cut(s) 271
BsuRI GGCC 1 cut(s) 127
BtsIMutI CAGTG 2 cut(s) 147, 162
CfoI GCGC 2 cut(s) 21, 79
CsiI ACCWGGT 1 cut(s) 247
CviAII CATG 4 cut(s) 85, 179, 265, 269
CviJI RGCY 6 cut(s) 28, 95, 112, 127, 134, 283
CviKI_1 RGCY 6 cut(s) 28, 95, 112, 127, 134, 283
DdeI CTNAG 2 cut(s) 6, 120
EcoRII CCWGG 1 cut(s) 247
EcoT22I ATGCAT 1 cut(s) 270
FaeI CATG 4 cut(s) 88, 182, 268, 272
FaiI YATR 7 cut(s) 45, 75, 86, 180, 260, 266, 270
FatI CATG 4 cut(s) 84, 178, 264, 268
GlaI GCGC 2 cut(s) 20, 78
HaeIII GGCC 1 cut(s) 127
HhaI GCGC 2 cut(s) 21, 79
Hin1II CATG 4 cut(s) 88, 182, 268, 272
Hin6I GCGC 2 cut(s) 19, 77
HinP1I GCGC 2 cut(s) 19, 77
HinfI GANTC 1 cut(s) 218
Hpy188I TCNGA 2 cut(s) 9, 121
Hpy188III TCNNGA 1 cut(s) 37
HpyAV CCTTC 1 cut(s) 90
HpyCH4III ACNGT 5 cut(s) 68, 91, 142, 157, 289
HpyCH4V TGCA 1 cut(s) 268
HpyF10VI GCNNNNNNNGC 1 cut(s) 25
HpyF3I CTNAG 2 cut(s) 6, 120
Hsp92II CATG 4 cut(s) 88, 182, 268, 272
HspAI GCGC 2 cut(s) 19, 77
LmnI GCTCC 1 cut(s) 16
LpnPI CCDG 3 cut(s) 22, 234, 261
MabI ACCWGGT 1 cut(s) 247
MaeIII GTNAC 2 cut(s) 142, 239
MhlI GDGCHC 1 cut(s) 66
MnlI CCTC 2 cut(s) 7, 138
Mph1103I ATGCAT 1 cut(s) 270
MseI TTAA 2 cut(s) 30, 102
MslI CAYNNNNRTG 1 cut(s) 269
MspCI CTTAAG 2 cut(s) 29, 101
MspR9I CCNGG 1 cut(s) 249
MvaI CCWGG 1 cut(s) 249
MwoI GCNNNNNNNGC 1 cut(s) 25
NlaIII CATG 4 cut(s) 88, 182, 268, 272
NmuCI GTSAC 1 cut(s) 142
NsiI ATGCAT 1 cut(s) 270
NspI RCATGY 1 cut(s) 272
PfeI GAWTC 1 cut(s) 218
PsiI TTATAA 1 cut(s) 260
Psp6I CCWGG 1 cut(s) 247
PspGI CCWGG 1 cut(s) 247
RseI CAYNNNNRTG 1 cut(s) 269
SaqAI TTAA 2 cut(s) 30, 102
ScrFI CCNGG 1 cut(s) 249
SduI GDGCHC 1 cut(s) 66
SetI ASST 4 cut(s) 30, 97, 250, 310
SexAI ACCWGGT 1 cut(s) 247
SfcI CTRYAG 1 cut(s) 90
SmiMI CAYNNNNRTG 1 cut(s) 269
SmlI CTYRAG 3 cut(s) 29, 101, 129
SmoI CTYRAG 3 cut(s) 29, 101, 129
StyD4I CCNGG 1 cut(s) 247
TaaI ACNGT 5 cut(s) 68, 91, 142, 157, 289
TfiI GAWTC 1 cut(s) 218
Tru1I TTAA 2 cut(s) 30, 102
Tru9I TTAA 2 cut(s) 30, 102
TscAI CASTG 2 cut(s) 147, 162
TseFI GTSAC 1 cut(s) 142
Tsp45I GTSAC 1 cut(s) 142
TspDTI ATGAA 1 cut(s) 177
TspRI CASTG 2 cut(s) 147, 162
Vha464I CTTAAG 2 cut(s) 29, 101
XceI RCATGY 1 cut(s) 272
Zsp2I ATGCAT 1 cut(s) 270
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.