MD11G1299700.v1.1

May serve as docking site to facilitate the association of other proteins to the plasma membrane

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
OG0013616
Physical Location & Seq
Reverse (-)
41606461 .. 41609135
2675 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1299700.v1.1.491

Sequence Viewer

Length: 363 bp
ATGGGGCAAAGAGGGGAGCATATAGCACTCAAGTTCCGGATTTACGACGGGACAGATATAGGAATCAATACTTATGCACCATCTATGACAGTATCATCTCTTAAGAAAAGGCTACTTGCTGAGTGGCCTCATGCAAAAACAGTAACACCGAAGTCAGTAGACGAAGTAAAAATCATACATGGTGGCAAAGTTTTAGAGAATAGCAAGACACTTGCTGATTCCAGAATAACCACCGGTAACCAGACCGGTGAGGCTGTGATCATGCATGCAGTAGTACAGCCTCTTGTACCCAAAAACAAAAGGACAGGAAAAAAACAGAAAGATATGCAAAAGATGAATTCATGCTCCTGCACCCTCCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Rad60-SLD_2

Protein Analysis

121

Amino Acids

13.22

Weight (kDa)

9.81

Isoelectric Point (pI)

37.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD_2 PF13881 6 - 118 4.7e-33 Ubiquitin-2 like Rad60 SUMO-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 159
AccIII TCCGGA 1 cut(s) 36
AcsI RAATTY 1 cut(s) 337
AfaI GTAC 2 cut(s) 276, 288
AflII CTTAAG 1 cut(s) 101
AgeI ACCGGT 2 cut(s) 233, 245
Aor13HI TCCGGA 1 cut(s) 36
AoxI GGCC 1 cut(s) 125
ApoI RAATTY 1 cut(s) 337
AsiGI ACCGGT 2 cut(s) 233, 245
AsuHPI GGTGA 1 cut(s) 260
BccI CCATC 1 cut(s) 88
BclI TGATCA 1 cut(s) 258
BfrI CTTAAG 1 cut(s) 101
BpuEI CTTGAG 1 cut(s) 14
BsaWI WCCGGW 3 cut(s) 36, 233, 245
Bse118I RCCGGY 2 cut(s) 233, 245
BseAI TCCGGA 1 cut(s) 36
BseMII CTCAG 1 cut(s) 111
BsgI GTGCAG 1 cut(s) 334
BshFI GGCC 1 cut(s) 127
BshTI ACCGGT 2 cut(s) 233, 245
BsiSI CCGG 3 cut(s) 37, 234, 246
BslFI GGGAC 1 cut(s) 64
BsmFI GGGAC 1 cut(s) 64
BsnI GGCC 1 cut(s) 127
Bsp13I TCCGGA 1 cut(s) 36
Bsp143I GATC 1 cut(s) 258
BspANI GGCC 1 cut(s) 127
BspCNI CTCAG 1 cut(s) 112
BspEI TCCGGA 1 cut(s) 36
BspTI CTTAAG 1 cut(s) 101
BsrFI RCCGGY 2 cut(s) 233, 245
BssAI RCCGGY 2 cut(s) 233, 245
BssMI GATC 1 cut(s) 258
Bst4CI ACNGT 2 cut(s) 91, 142
BstAFI CTTAAG 1 cut(s) 101
BstC8I GCNNGC 1 cut(s) 267
BstDEI CTNAG 1 cut(s) 120
BstEII GGTNACC 1 cut(s) 236
BstKTI GATC 1 cut(s) 261
BstMBI GATC 1 cut(s) 258
BstNSI RCATGY 1 cut(s) 269
BstPI GGTNACC 1 cut(s) 236
BsuRI GGCC 1 cut(s) 127
Cac8I GCNNGC 1 cut(s) 267
Cfr10I RCCGGY 2 cut(s) 233, 245
Csp6I GTAC 2 cut(s) 275, 287
CspAI ACCGGT 2 cut(s) 233, 245
CviAII CATG 5 cut(s) 131, 179, 262, 266, 342
CviJI RGCY 4 cut(s) 112, 127, 254, 280
CviKI_1 RGCY 4 cut(s) 112, 127, 254, 280
CviQI GTAC 2 cut(s) 275, 287
DdeI CTNAG 1 cut(s) 120
DpnI GATC 1 cut(s) 260
DpnII GATC 1 cut(s) 258
Eco91I GGTNACC 1 cut(s) 236
EcoO65I GGTNACC 1 cut(s) 236
EcoRI GAATTC 1 cut(s) 337
EcoT22I ATGCAT 1 cut(s) 267
FaeI CATG 5 cut(s) 134, 182, 265, 269, 345
FaqI GGGAC 1 cut(s) 64
FatI CATG 5 cut(s) 130, 178, 261, 265, 341
FbaI TGATCA 1 cut(s) 258
FblI GTMKAC 1 cut(s) 159
HaeIII GGCC 1 cut(s) 127
HapII CCGG 3 cut(s) 37, 234, 246
Hin1II CATG 5 cut(s) 134, 182, 265, 269, 345
HinfI GANTC 2 cut(s) 63, 218
HpaII CCGG 3 cut(s) 37, 234, 246
HphI GGTGA 1 cut(s) 260
Hpy166II GTNNAC 1 cut(s) 160
Hpy188III TCNNGA 2 cut(s) 37, 222
Hpy8I GTNNAC 1 cut(s) 160
Hpy99I CGWCG 1 cut(s) 50
HpyCH4III ACNGT 2 cut(s) 91, 142
HpyCH4V TGCA 6 cut(s) 77, 134, 265, 269, 328, 351
HpyF3I CTNAG 1 cut(s) 120
Hsp92II CATG 5 cut(s) 134, 182, 265, 269, 345
Kpn2I TCCGGA 1 cut(s) 36
Ksp22I TGATCA 1 cut(s) 258
Kzo9I GATC 1 cut(s) 258
LmnI GCTCC 2 cut(s) 16, 350
LpnPI CCDG 6 cut(s) 50, 235, 247, 254, 259, 291
MaeIII GTNAC 2 cut(s) 142, 236
MalI GATC 1 cut(s) 260
MboI GATC 1 cut(s) 258
MluCI AATT 1 cut(s) 337
MnlI CCTC 4 cut(s) 5, 138, 244, 291
Mph1103I ATGCAT 1 cut(s) 267
MroI TCCGGA 1 cut(s) 36
MseI TTAA 2 cut(s) 102, 361
MspCI CTTAAG 1 cut(s) 101
MspI CCGG 3 cut(s) 37, 234, 246
NdeII GATC 1 cut(s) 258
NlaIII CATG 5 cut(s) 134, 182, 265, 269, 345
NsiI ATGCAT 1 cut(s) 267
NspI RCATGY 1 cut(s) 269
PaeI GCATGC 1 cut(s) 269
PfeI GAWTC 2 cut(s) 63, 218
PinAI ACCGGT 2 cut(s) 233, 245
PspEI GGTNACC 1 cut(s) 236
RsaI GTAC 2 cut(s) 276, 288
RsaNI GTAC 2 cut(s) 275, 287
SaqAI TTAA 2 cut(s) 102, 361
Sau3AI GATC 1 cut(s) 258
SmlI CTYRAG 2 cut(s) 29, 101
SmoI CTYRAG 2 cut(s) 29, 101
SphI GCATGC 1 cut(s) 269
Sse9I AATT 1 cut(s) 337
TaaI ACNGT 2 cut(s) 91, 142
TasI AATT 1 cut(s) 337
TatI WGTACW 1 cut(s) 274
TfiI GAWTC 2 cut(s) 63, 218
Tru1I TTAA 2 cut(s) 102, 361
Tru9I TTAA 2 cut(s) 102, 361
TspDTI ATGAA 2 cut(s) 330, 350
Vha464I CTTAAG 1 cut(s) 101
XapI RAATTY 1 cut(s) 337
XceI RCATGY 1 cut(s) 269
XmiI GTMKAC 1 cut(s) 159
Zsp2I ATGCAT 1 cut(s) 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.