Rw6G029960

May serve as docking site to facilitate the association of other proteins to the plasma membrane

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
Physical Location & Seq
Reverse (-)
54108062 .. 54109841
1780 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G029960.1

Sequence Viewer

Length: 363 bp
ATGTCTCAGAGAGAGGAGCGCATTGAGCTTAAGTTCAGGATTTATGATGGAACAGATATTGGGCACAGTTCTTATGCGCCTTCCATGACTGTAGCTACTCTTAAGAAAAGGCTACTTTCTGAGTGGCCTCAAGCCAAAACAGTGACACCCAAGACAGTGAATGAAGTGAAACTGATACATGGTGGGAGAGTTTTAGAGAATAGTAAGACACTTGCTGATTCCAAAATAATGTCCTTTGGTAACTTACCTGGTGGTGTTATAACCATGCATGTGGTAGTTCAGCCTACTGTTGCTAAAGAGAAAAAAGCTAAAAACCAGAAGGATATGCAAAAGATGAATTCATGCTCGTGTACCATTCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

120

Amino Acids

13.38

Weight (kDa)

9.7

Isoelectric Point (pI)

55.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD_2 PF13881 6 - 118 8.7e-38 Ubiquitin-2 like Rad60 SUMO-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 260
AcsI RAATTY 1 cut(s) 337
AfaI GTAC 1 cut(s) 352
AflII CTTAAG 2 cut(s) 29, 101
AjnI CCWGG 1 cut(s) 247
AluBI AGCT 3 cut(s) 28, 95, 308
AluI AGCT 3 cut(s) 28, 95, 308
Alw26I GTCTC 1 cut(s) 9
AoxI GGCC 1 cut(s) 125
ApoI RAATTY 1 cut(s) 337
AspLEI GCGC 2 cut(s) 21, 79
BaeGI GKGCMC 1 cut(s) 66
BauI CACGAG 1 cut(s) 346
BccI CCATC 1 cut(s) 41
BciT130I CCWGG 1 cut(s) 249
BcoDI GTCTC 1 cut(s) 9
BfmI CTRYAG 1 cut(s) 90
BfrI CTTAAG 2 cut(s) 29, 101
Bme1390I CCNGG 1 cut(s) 249
BmrFI CCNGG 1 cut(s) 249
BpuEI CTTGAG 1 cut(s) 114
BseBI CCWGG 1 cut(s) 249
BseMII CTCAG 2 cut(s) 20, 111
BseRI GAGGAG 1 cut(s) 29
BseSI GKGCMC 1 cut(s) 66
BshFI GGCC 1 cut(s) 127
BsmAI GTCTC 1 cut(s) 9
BsnI GGCC 1 cut(s) 127
Bsp1286I GDGCHC 1 cut(s) 66
BspANI GGCC 1 cut(s) 127
BspCNI CTCAG 2 cut(s) 19, 112
BspTI CTTAAG 2 cut(s) 29, 101
BssSI CACGAG 1 cut(s) 346
Bst2BI CACGAG 1 cut(s) 346
Bst2UI CCWGG 1 cut(s) 249
Bst4CI ACNGT 5 cut(s) 68, 91, 142, 157, 289
BstAFI CTTAAG 2 cut(s) 29, 101
BstDEI CTNAG 2 cut(s) 6, 120
BstHHI GCGC 2 cut(s) 21, 79
BstMAI GTCTC 1 cut(s) 9
BstMWI GCNNNNNNNGC 1 cut(s) 25
BstNI CCWGG 1 cut(s) 249
BstNSI RCATGY 1 cut(s) 272
BstSCI CCNGG 1 cut(s) 247
BstSFI CTRYAG 1 cut(s) 90
BstSLI GKGCMC 1 cut(s) 66
BstXI CCANNNNNNTGG 1 cut(s) 271
BsuRI GGCC 1 cut(s) 127
BtsIMutI CAGTG 2 cut(s) 147, 162
CfoI GCGC 2 cut(s) 21, 79
CsiI ACCWGGT 1 cut(s) 247
Csp6I GTAC 1 cut(s) 351
CviAII CATG 5 cut(s) 85, 179, 265, 269, 342
CviJI RGCY 7 cut(s) 28, 95, 112, 127, 134, 283, 308
CviKI_1 RGCY 7 cut(s) 28, 95, 112, 127, 134, 283, 308
CviQI GTAC 1 cut(s) 351
DdeI CTNAG 2 cut(s) 6, 120
EcoRI GAATTC 1 cut(s) 337
EcoRII CCWGG 1 cut(s) 247
EcoT22I ATGCAT 1 cut(s) 270
FaeI CATG 5 cut(s) 88, 182, 268, 272, 345
FaiI YATR 9 cut(s) 45, 75, 86, 180, 260, 266, 270, 326, 343
FatI CATG 5 cut(s) 84, 178, 264, 268, 341
GlaI GCGC 2 cut(s) 20, 78
HaeIII GGCC 1 cut(s) 127
HhaI GCGC 2 cut(s) 21, 79
Hin1II CATG 5 cut(s) 88, 182, 268, 272, 345
Hin6I GCGC 2 cut(s) 19, 77
HinP1I GCGC 2 cut(s) 19, 77
HinfI GANTC 1 cut(s) 218
Hpy166II GTNNAC 1 cut(s) 351
Hpy188I TCNGA 2 cut(s) 9, 121
Hpy188III TCNNGA 1 cut(s) 37
Hpy8I GTNNAC 1 cut(s) 351
HpyAV CCTTC 2 cut(s) 90, 313
HpyCH4III ACNGT 5 cut(s) 68, 91, 142, 157, 289
HpyCH4V TGCA 2 cut(s) 268, 328
HpyF10VI GCNNNNNNNGC 1 cut(s) 25
HpyF3I CTNAG 2 cut(s) 6, 120
Hsp92II CATG 5 cut(s) 88, 182, 268, 272, 345
HspAI GCGC 2 cut(s) 19, 77
LmnI GCTCC 1 cut(s) 16
LpnPI CCDG 4 cut(s) 22, 234, 261, 329
MabI ACCWGGT 1 cut(s) 247
MaeIII GTNAC 2 cut(s) 142, 239
MhlI GDGCHC 1 cut(s) 66
MluCI AATT 1 cut(s) 337
MnlI CCTC 2 cut(s) 7, 138
Mph1103I ATGCAT 1 cut(s) 270
MseI TTAA 3 cut(s) 30, 102, 361
MslI CAYNNNNRTG 2 cut(s) 269, 346
MspCI CTTAAG 2 cut(s) 29, 101
MspR9I CCNGG 1 cut(s) 249
MvaI CCWGG 1 cut(s) 249
MwoI GCNNNNNNNGC 1 cut(s) 25
NlaIII CATG 5 cut(s) 88, 182, 268, 272, 345
NmuCI GTSAC 1 cut(s) 142
NsiI ATGCAT 1 cut(s) 270
NspI RCATGY 1 cut(s) 272
PfeI GAWTC 1 cut(s) 218
PsiI TTATAA 1 cut(s) 260
Psp6I CCWGG 1 cut(s) 247
PspGI CCWGG 1 cut(s) 247
RsaI GTAC 1 cut(s) 352
RsaNI GTAC 1 cut(s) 351
RseI CAYNNNNRTG 2 cut(s) 269, 346
SaqAI TTAA 3 cut(s) 30, 102, 361
ScrFI CCNGG 1 cut(s) 249
SduI GDGCHC 1 cut(s) 66
SetI ASST 4 cut(s) 30, 97, 250, 310
SexAI ACCWGGT 1 cut(s) 247
SfcI CTRYAG 1 cut(s) 90
SmiMI CAYNNNNRTG 2 cut(s) 269, 346
SmlI CTYRAG 3 cut(s) 29, 101, 129
SmoI CTYRAG 3 cut(s) 29, 101, 129
Sse9I AATT 1 cut(s) 337
StyD4I CCNGG 1 cut(s) 247
TaaI ACNGT 5 cut(s) 68, 91, 142, 157, 289
TasI AATT 1 cut(s) 337
TfiI GAWTC 1 cut(s) 218
Tru1I TTAA 3 cut(s) 30, 102, 361
Tru9I TTAA 3 cut(s) 30, 102, 361
TscAI CASTG 2 cut(s) 147, 162
TseFI GTSAC 1 cut(s) 142
Tsp45I GTSAC 1 cut(s) 142
TspDTI ATGAA 3 cut(s) 177, 330, 350
TspRI CASTG 2 cut(s) 147, 162
Vha464I CTTAAG 2 cut(s) 29, 101
XapI RAATTY 1 cut(s) 337
XceI RCATGY 1 cut(s) 272
Zsp2I ATGCAT 1 cut(s) 270
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.