FvH4_2g36070

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
Physical Location & Seq
Reverse (-)
26481764 .. 26482865
1102 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g36070.t1

Sequence Viewer

Length: 252 bp
ATGGTAGAGTTTAATGGGTCGCTTCTAATTTGCAGGAAACGAATAATAGAGGACTTCGCAGGAACTGAGTTGCACGATTCTACTAAGGCTTCAAAGAAGGCTGAAGATTCAGCTACGTTGCCTCAGACTAGAAGATTCAAGGTTGAGTTGACGATAAGGTTGATGAACATAATGGGTAGTGTCAAGAAGGAAATGCATGGCTGGAAGATAAAAAAAAATCCTGGAAATGCATGGCTGGAATTATATGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

9.57

Weight (kDa)

9.41

Isoelectric Point (pI)

48.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 123
AgsI TTSAA 2 cut(s) 93, 139
AjnI CCWGG 1 cut(s) 220
AluBI AGCT 1 cut(s) 113
AluI AGCT 1 cut(s) 113
AlwNI CAGNNNCTG 1 cut(s) 65
BciT130I CCWGG 1 cut(s) 222
BfaI CTAG 1 cut(s) 129
Bme1390I CCNGG 1 cut(s) 222
BmrFI CCNGG 1 cut(s) 222
BseBI CCWGG 1 cut(s) 222
BseMII CTCAG 2 cut(s) 57, 137
BspCNI CTCAG 2 cut(s) 58, 136
Bst2UI CCWGG 1 cut(s) 222
BstDEI CTNAG 3 cut(s) 66, 84, 123
BstNI CCWGG 1 cut(s) 222
BstSCI CCNGG 1 cut(s) 220
CaiI CAGNNNCTG 1 cut(s) 65
CviAII CATG 2 cut(s) 197, 231
CviJI RGCY 5 cut(s) 89, 101, 113, 201, 235
CviKI_1 RGCY 5 cut(s) 89, 101, 113, 201, 235
DdeI CTNAG 3 cut(s) 66, 84, 123
Eco57I CTGAAG 1 cut(s) 123
EcoRII CCWGG 1 cut(s) 220
EcoT22I ATGCAT 2 cut(s) 198, 232
FaeI CATG 2 cut(s) 200, 234
FaiI YATR 5 cut(s) 170, 198, 232, 244, 246
FatI CATG 2 cut(s) 196, 230
FspBI CTAG 1 cut(s) 129
Hin1II CATG 2 cut(s) 200, 234
HincII GTYRAC 1 cut(s) 150
HindII GTYRAC 1 cut(s) 150
HinfI GANTC 3 cut(s) 77, 107, 135
Hpy166II GTNNAC 1 cut(s) 150
Hpy188I TCNGA 1 cut(s) 126
Hpy188III TCNNGA 1 cut(s) 184
Hpy8I GTNNAC 1 cut(s) 150
HpyAV CCTTC 2 cut(s) 91, 181
HpyCH4IV ACGT 1 cut(s) 116
HpyCH4V TGCA 4 cut(s) 33, 73, 196, 230
HpyF3I CTNAG 3 cut(s) 66, 84, 123
HpySE526I ACGT 1 cut(s) 116
Hsp92II CATG 2 cut(s) 200, 234
LpnPI CCDG 6 cut(s) 19, 45, 187, 207, 221, 234
MaeI CTAG 1 cut(s) 129
MaeII ACGT 1 cut(s) 116
MboII GAAGA 3 cut(s) 116, 144, 217
MluCI AATT 2 cut(s) 27, 239
MnlI CCTC 2 cut(s) 43, 132
Mph1103I ATGCAT 2 cut(s) 198, 232
MseI TTAA 2 cut(s) 12, 250
MspR9I CCNGG 1 cut(s) 222
MvaI CCWGG 1 cut(s) 222
NlaIII CATG 2 cut(s) 200, 234
NsiI ATGCAT 2 cut(s) 198, 232
PfeI GAWTC 3 cut(s) 77, 107, 135
PfoI TCCNGGA 1 cut(s) 220
Psp6I CCWGG 1 cut(s) 220
PspGI CCWGG 1 cut(s) 220
PstNI CAGNNNCTG 1 cut(s) 65
SaqAI TTAA 2 cut(s) 12, 250
ScrFI CCNGG 1 cut(s) 222
SetI ASST 4 cut(s) 115, 119, 144, 161
Sse9I AATT 2 cut(s) 27, 239
SspMI CTAG 1 cut(s) 129
StyD4I CCNGG 1 cut(s) 220
TaiI ACGT 1 cut(s) 119
TasI AATT 2 cut(s) 27, 239
TfiI GAWTC 3 cut(s) 77, 107, 135
Tru1I TTAA 2 cut(s) 12, 250
Tru9I TTAA 2 cut(s) 12, 250
TspDTI ATGAA 1 cut(s) 179
XspI CTAG 1 cut(s) 129
Zsp2I ATGCAT 2 cut(s) 198, 232
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.