RchiOBHm_Chr7g0235231
ERF Family

Belongs to the TRAFAC class myosin-kinesin ATPase superfamily. Kinesin family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
59962397 .. 59962797
401 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21083

Sequence Viewer

Length: 150 bp
ATGGGGTTTAATTGTCAGATTCTAATTTGCAAGAAACGAGTGATGGAGGACCGATCAAGAACTGGGTTGCACGATGTTACTAGGGCTTCAAGAAAGGCTAAAGAATCAGCCTGGAGGCGAGCTGGGCATGGGTCAGGCCTTGTTCGGTGA

Protein Analysis

49

Amino Acids

5.57

Weight (kDa)

11.26

Isoelectric Point (pI)

47.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 90
AjnI CCWGG 1 cut(s) 110
AluBI AGCT 1 cut(s) 122
AluI AGCT 1 cut(s) 122
AoxI GGCC 1 cut(s) 136
AspS9I GGNCC 1 cut(s) 49
AvaII GGWCC 1 cut(s) 49
BccI CCATC 1 cut(s) 37
BciT130I CCWGG 1 cut(s) 112
BfaI CTAG 1 cut(s) 81
Bme1390I CCNGG 1 cut(s) 112
Bme18I GGWCC 1 cut(s) 49
BmgT120I GGNCC 1 cut(s) 49
BmrFI CCNGG 1 cut(s) 112
BmrI ACTGGG 1 cut(s) 72
BmuI ACTGGG 1 cut(s) 72
BpmI CTGGAG 1 cut(s) 133
Bse1I ACTGG 1 cut(s) 67
BseBI CCWGG 1 cut(s) 112
BseNI ACTGG 1 cut(s) 67
BseYI CCCAGC 1 cut(s) 122
BshFI GGCC 1 cut(s) 138
BsnI GGCC 1 cut(s) 138
Bsp143I GATC 1 cut(s) 53
BspANI GGCC 1 cut(s) 138
BsrI ACTGG 1 cut(s) 67
BssMI GATC 1 cut(s) 53
Bst2UI CCWGG 1 cut(s) 112
BstC8I GCNNGC 1 cut(s) 120
BstKTI GATC 1 cut(s) 56
BstMBI GATC 1 cut(s) 53
BstMWI GCNNNNNNNGC 1 cut(s) 124
BstNI CCWGG 1 cut(s) 112
BstSCI CCNGG 1 cut(s) 110
BsuRI GGCC 1 cut(s) 138
Cac8I GCNNGC 1 cut(s) 120
Cfr13I GGNCC 1 cut(s) 49
CviAII CATG 1 cut(s) 128
CviJI RGCY 5 cut(s) 86, 98, 110, 122, 138
CviKI_1 RGCY 5 cut(s) 86, 98, 110, 122, 138
DpnI GATC 1 cut(s) 55
DpnII GATC 1 cut(s) 53
Eco147I AGGCCT 1 cut(s) 138
Eco47I GGWCC 1 cut(s) 49
EcoRII CCWGG 1 cut(s) 110
FaeI CATG 1 cut(s) 131
FaiI YATR 1 cut(s) 129
FatI CATG 1 cut(s) 127
FspBI CTAG 1 cut(s) 81
GsaI CCCAGC 1 cut(s) 126
GsuI CTGGAG 1 cut(s) 133
HaeIII GGCC 1 cut(s) 138
Hin1II CATG 1 cut(s) 131
HinfI GANTC 2 cut(s) 19, 104
Hpy188I TCNGA 1 cut(s) 18
Hpy188III TCNNGA 2 cut(s) 57, 90
HpyCH4V TGCA 2 cut(s) 30, 70
HpyF10VI GCNNNNNNNGC 1 cut(s) 124
Hsp92II CATG 1 cut(s) 131
Kzo9I GATC 1 cut(s) 53
LpnPI CCDG 5 cut(s) 48, 97, 108, 120, 124
MaeI CTAG 1 cut(s) 81
MaeIII GTNAC 1 cut(s) 76
MalI GATC 1 cut(s) 55
MboI GATC 1 cut(s) 53
MluCI AATT 2 cut(s) 10, 24
MnlI CCTC 2 cut(s) 40, 108
MseI TTAA 1 cut(s) 9
MspR9I CCNGG 1 cut(s) 112
MvaI CCWGG 1 cut(s) 112
MwoI GCNNNNNNNGC 1 cut(s) 124
NdeII GATC 1 cut(s) 53
NlaIII CATG 1 cut(s) 131
PceI AGGCCT 1 cut(s) 138
PfeI GAWTC 2 cut(s) 19, 104
Psp6I CCWGG 1 cut(s) 110
PspFI CCCAGC 1 cut(s) 122
PspGI CCWGG 1 cut(s) 110
PspPI GGNCC 1 cut(s) 49
SaqAI TTAA 1 cut(s) 9
Sau3AI GATC 1 cut(s) 53
Sau96I GGNCC 1 cut(s) 49
ScrFI CCNGG 1 cut(s) 112
SetI ASST 1 cut(s) 124
SinI GGWCC 1 cut(s) 49
Sse9I AATT 2 cut(s) 10, 24
SseBI AGGCCT 1 cut(s) 138
SspMI CTAG 1 cut(s) 81
StuI AGGCCT 1 cut(s) 138
StyD4I CCNGG 1 cut(s) 110
TaqII GACCGA 1 cut(s) 66
TasI AATT 2 cut(s) 10, 24
TfiI GAWTC 2 cut(s) 19, 104
Tru1I TTAA 1 cut(s) 9
Tru9I TTAA 1 cut(s) 9
VpaK11BI GGWCC 1 cut(s) 49
XspI CTAG 1 cut(s) 81
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.