FvH4_3g27460

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb3
Physical Location & Seq
Reverse (-)
20512587 .. 20512992
406 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_3g27460.t1

Sequence Viewer

Length: 201 bp
ATGTTGATCTGCAGGAAATCCCTACGGTTTGGCATTCTAAATATCAGTTTCTGGCTGAAAGTTGGTTTATATTGGGCGGGTCTCAAATCAGTTTCTGTGAGGAGTAGAGGAGGGGGATTGGGTTTCGGTGGAGGGAGAGGGAGAGGCAGAGGGACAGAGTTTCCGGCGGGATGTCGAGAGGGGGAGGAACTGGGGGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.09

Weight (kDa)

10.41

Isoelectric Point (pI)

37.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 77, 167
Alw26I GTCTC 1 cut(s) 86
AlwNI CAGNNNCTG 2 cut(s) 51, 95
BcoDI GTCTC 1 cut(s) 86
BfaI CTAG 1 cut(s) 199
BfmI CTRYAG 1 cut(s) 10
BmrI ACTGGG 1 cut(s) 200
BmuI ACTGGG 1 cut(s) 200
BsaI GGTCTC 1 cut(s) 86
Bse1I ACTGG 1 cut(s) 195
BseGI GGATG 1 cut(s) 176
BseNI ACTGG 1 cut(s) 195
BseRI GAGGAG 2 cut(s) 115, 123
BsiSI CCGG 1 cut(s) 164
BslFI GGGAC 1 cut(s) 166
BsmAI GTCTC 1 cut(s) 86
BsmFI GGGAC 1 cut(s) 166
BsmI GAATGC 1 cut(s) 33
Bso31I GGTCTC 1 cut(s) 86
Bsp143I GATC 1 cut(s) 6
BspACI CCGC 2 cut(s) 77, 167
BspMAI CTGCAG 1 cut(s) 14
BspTNI GGTCTC 1 cut(s) 86
BsrI ACTGG 1 cut(s) 195
BssMI GATC 1 cut(s) 6
Bst4CI ACNGT 1 cut(s) 27
BstF5I GGATG 1 cut(s) 176
BstKTI GATC 1 cut(s) 9
BstMAI GTCTC 1 cut(s) 86
BstMBI GATC 1 cut(s) 6
BstSFI CTRYAG 1 cut(s) 10
BtsCI GGATG 1 cut(s) 176
CaiI CAGNNNCTG 2 cut(s) 51, 95
CviJI RGCY 1 cut(s) 55
CviKI_1 RGCY 1 cut(s) 55
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
Eco31I GGTCTC 1 cut(s) 86
FaiI YATR 1 cut(s) 70
FaqI GGGAC 1 cut(s) 166
FauI CCCGC 2 cut(s) 70, 160
FokI GGATG 1 cut(s) 183
FspBI CTAG 1 cut(s) 199
HapII CCGG 1 cut(s) 164
HpaII CCGG 1 cut(s) 164
Hpy188III TCNNGA 1 cut(s) 176
HpyCH4III ACNGT 1 cut(s) 27
HpyCH4V TGCA 1 cut(s) 12
Kzo9I GATC 1 cut(s) 6
LpnPI CCDG 3 cut(s) 37, 176, 177
MaeI CTAG 1 cut(s) 199
MalI GATC 1 cut(s) 8
MboI GATC 1 cut(s) 6
MnlI CCTC 9 cut(s) 93, 101, 104, 125, 131, 137, 143, 172, 178
MspI CCGG 1 cut(s) 164
Mva1269I GAATGC 1 cut(s) 33
NdeII GATC 1 cut(s) 6
PctI GAATGC 1 cut(s) 33
PstI CTGCAG 1 cut(s) 14
PstNI CAGNNNCTG 2 cut(s) 51, 95
Sau3AI GATC 1 cut(s) 6
SfcI CTRYAG 1 cut(s) 10
SgeI CNNG 6 cut(s) 25, 64, 90, 176, 180, 188
SsiI CCGC 2 cut(s) 77, 167
SspMI CTAG 1 cut(s) 199
TaaI ACNGT 1 cut(s) 27
TaqI TCGA 1 cut(s) 175
XspI CTAG 1 cut(s) 199
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.