Rh3BG364300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Reverse (-)
44731052 .. 44737623
6572 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG364300.1

Sequence Viewer

Length: 216 bp
ATGGAGGACCAATCAAGAACTAGGTTGCACGATTTTACTAGGGCTTCAAGAAAGGCTGAAGAATCAGGCATATCTGAAACAGGGATTCTAGGAACTTGCTGCAGAGGGGCTTTGGCAAATGCTTCTGGAGGTGTAATTGGCCAATTCATTGAGGGGTCTGTTATGCTACATATGAAGCAGAGCTGTACTAATTGGGATCAGCAATGCAGAGGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

7.72

Weight (kDa)

6.7

Isoelectric Point (pI)

51.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 204
AcoI YGGCCR 1 cut(s) 139
AcuI CTGAAG 1 cut(s) 78
AfaI GTAC 1 cut(s) 187
AgsI TTSAA 1 cut(s) 48
AluBI AGCT 1 cut(s) 183
AluI AGCT 1 cut(s) 183
AlwI GGATC 1 cut(s) 204
AoxI GGCC 1 cut(s) 139
ApeKI GCWGC 1 cut(s) 99
AspS9I GGNCC 1 cut(s) 7
AvaII GGWCC 1 cut(s) 7
BalI TGGCCA 1 cut(s) 141
BbvI GCAGC 1 cut(s) 86
BfaI CTAG 3 cut(s) 21, 39, 89
BfmI CTRYAG 1 cut(s) 100
BisI GCNGC 1 cut(s) 100
BlsI GCNGC 1 cut(s) 101
Bme18I GGWCC 1 cut(s) 7
BmgT120I GGNCC 1 cut(s) 7
BpmI CTGGAG 1 cut(s) 147
Bse3DI GCAATG 1 cut(s) 209
BseMI GCAATG 1 cut(s) 209
BseXI GCAGC 1 cut(s) 86
BshFI GGCC 1 cut(s) 141
BsnI GGCC 1 cut(s) 141
Bsp143I GATC 1 cut(s) 196
BspANI GGCC 1 cut(s) 141
BspMAI CTGCAG 1 cut(s) 104
BspPI GGATC 1 cut(s) 204
BsrDI GCAATG 1 cut(s) 209
BssMI GATC 1 cut(s) 196
BstKTI GATC 1 cut(s) 199
BstMBI GATC 1 cut(s) 196
BstSFI CTRYAG 1 cut(s) 100
BstV1I GCAGC 1 cut(s) 86
BsuRI GGCC 1 cut(s) 141
Cfr13I GGNCC 1 cut(s) 7
Csp6I GTAC 1 cut(s) 186
CviJI RGCY 5 cut(s) 44, 56, 110, 141, 183
CviKI_1 RGCY 5 cut(s) 44, 56, 110, 141, 183
CviQI GTAC 1 cut(s) 186
DpnI GATC 1 cut(s) 198
DpnII GATC 1 cut(s) 196
EaeI YGGCCR 1 cut(s) 139
Eco47I GGWCC 1 cut(s) 7
Eco57I CTGAAG 1 cut(s) 78
FaiI YATR 4 cut(s) 71, 164, 171, 173
FauNDI CATATG 1 cut(s) 171
Fnu4HI GCNGC 1 cut(s) 100
Fsp4HI GCNGC 1 cut(s) 100
FspBI CTAG 3 cut(s) 21, 39, 89
GluI GCNGC 1 cut(s) 100
GsuI CTGGAG 1 cut(s) 147
HaeIII GGCC 1 cut(s) 141
HinfI GANTC 2 cut(s) 62, 85
Hpy188I TCNGA 1 cut(s) 76
Hpy188III TCNNGA 3 cut(s) 15, 48, 126
HpyCH4V TGCA 3 cut(s) 28, 102, 207
Kzo9I GATC 1 cut(s) 196
LpnPI CCDG 3 cut(s) 51, 66, 111
Lsp1109I GCAGC 1 cut(s) 86
MaeI CTAG 3 cut(s) 21, 39, 89
MalI GATC 1 cut(s) 198
MboI GATC 1 cut(s) 196
MboII GAAGA 1 cut(s) 71
MlsI TGGCCA 1 cut(s) 141
MluCI AATT 3 cut(s) 135, 143, 190
MluNI TGGCCA 1 cut(s) 141
MnlI CCTC 4 cut(s) 98, 122, 145, 203
Mox20I TGGCCA 1 cut(s) 141
MscI TGGCCA 1 cut(s) 141
Msp20I TGGCCA 1 cut(s) 141
NdeI CATATG 1 cut(s) 171
NdeII GATC 1 cut(s) 196
PfeI GAWTC 2 cut(s) 62, 85
PkrI GCNGC 1 cut(s) 101
PspPI GGNCC 1 cut(s) 7
PstI CTGCAG 1 cut(s) 104
RsaI GTAC 1 cut(s) 187
RsaNI GTAC 1 cut(s) 186
SatI GCNGC 1 cut(s) 100
Sau3AI GATC 1 cut(s) 196
Sau96I GGNCC 1 cut(s) 7
SetI ASST 3 cut(s) 26, 133, 185
SfcI CTRYAG 1 cut(s) 100
SinI GGWCC 1 cut(s) 7
Sse9I AATT 3 cut(s) 135, 143, 190
SspMI CTAG 3 cut(s) 21, 39, 89
TasI AATT 3 cut(s) 135, 143, 190
TatI WGTACW 1 cut(s) 185
TfiI GAWTC 2 cut(s) 62, 85
TseI GCWGC 1 cut(s) 99
TspDTI ATGAA 2 cut(s) 136, 188
VpaK11BI GGWCC 1 cut(s) 7
XspI CTAG 3 cut(s) 21, 39, 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.