FvH4_7g31600

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb7
Physical Location & Seq
Reverse (-)
22808155 .. 22808358
204 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_7g31600.t1

Sequence Viewer

Length: 204 bp
ATGAAAATAAGAATCCTGGATCGTTATGGATTTCCCACGGATCTGATGGCTTACACTCCTGGAACCAGCGCCATTGAGAAGATTGAGGTTGCTGGTATGCTAACAAGCGCCATTGAGGATGATGATATGCCGATGCACATGAGTTATATTATGCTCTTTGTTCCAAGCTTGGCCTCGCTTAAGTACATCATCTGGCTTTGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.62

Weight (kDa)

4.7

Isoelectric Point (pI)

58.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 27, 48
AfaI GTAC 1 cut(s) 185
AflII CTTAAG 1 cut(s) 179
AjnI CCWGG 2 cut(s) 15, 58
AluBI AGCT 1 cut(s) 168
AluI AGCT 1 cut(s) 168
AlwI GGATC 2 cut(s) 27, 48
AoxI GGCC 1 cut(s) 171
AspLEI GCGC 2 cut(s) 71, 110
BccI CCATC 1 cut(s) 40
BciT130I CCWGG 2 cut(s) 17, 60
BfaI CTAG 1 cut(s) 202
BfoI RGCGCY 2 cut(s) 72, 111
BfrI CTTAAG 1 cut(s) 179
Bme1390I CCNGG 2 cut(s) 17, 60
BmiI GGNNCC 1 cut(s) 64
BmrFI CCNGG 2 cut(s) 17, 60
BmsI GCATC 1 cut(s) 123
BsaJI CCNNGG 1 cut(s) 36
BseBI CCWGG 2 cut(s) 17, 60
BseDI CCNNGG 1 cut(s) 36
BseGI GGATG 1 cut(s) 124
BshFI GGCC 1 cut(s) 173
BsnI GGCC 1 cut(s) 173
Bsp143I GATC 2 cut(s) 19, 40
BspANI GGCC 1 cut(s) 173
BspLI GGNNCC 1 cut(s) 64
BspPI GGATC 2 cut(s) 27, 48
BspTI CTTAAG 1 cut(s) 179
BssECI CCNNGG 1 cut(s) 36
BssMI GATC 2 cut(s) 19, 40
Bst2UI CCWGG 2 cut(s) 17, 60
BstAFI CTTAAG 1 cut(s) 179
BstDSI CCRYGG 1 cut(s) 36
BstF5I GGATG 1 cut(s) 124
BstH2I RGCGCY 2 cut(s) 72, 111
BstHHI GCGC 2 cut(s) 71, 110
BstKTI GATC 2 cut(s) 22, 43
BstMBI GATC 2 cut(s) 19, 40
BstNI CCWGG 2 cut(s) 17, 60
BstSCI CCNGG 2 cut(s) 15, 58
BstX2I RGATCY 1 cut(s) 40
BstYI RGATCY 1 cut(s) 40
BsuRI GGCC 1 cut(s) 173
BtgI CCRYGG 1 cut(s) 36
BtsCI GGATG 1 cut(s) 124
CfoI GCGC 2 cut(s) 71, 110
Csp6I GTAC 1 cut(s) 184
CviAII CATG 1 cut(s) 139
CviJI RGCY 4 cut(s) 50, 168, 173, 196
CviKI_1 RGCY 4 cut(s) 50, 168, 173, 196
CviQI GTAC 1 cut(s) 184
DpnI GATC 2 cut(s) 21, 42
DpnII GATC 2 cut(s) 19, 40
EcoRII CCWGG 2 cut(s) 15, 58
FaeI CATG 1 cut(s) 142
FaiI YATR 6 cut(s) 27, 98, 128, 140, 147, 152
FatI CATG 1 cut(s) 138
FokI GGATG 1 cut(s) 131
FspBI CTAG 1 cut(s) 202
GlaI GCGC 2 cut(s) 70, 109
HaeII RGCGCY 2 cut(s) 72, 111
HaeIII GGCC 1 cut(s) 173
HhaI GCGC 2 cut(s) 71, 110
Hin1II CATG 1 cut(s) 142
Hin6I GCGC 2 cut(s) 69, 108
HinP1I GCGC 2 cut(s) 69, 108
HindIII AAGCTT 1 cut(s) 166
HinfI GANTC 1 cut(s) 12
Hpy188I TCNGA 1 cut(s) 45
HpyCH4V TGCA 1 cut(s) 136
Hsp92II CATG 1 cut(s) 142
HspAI GCGC 2 cut(s) 69, 108
Kzo9I GATC 2 cut(s) 19, 40
LpnPI CCDG 7 cut(s) 2, 29, 45, 72, 78, 79, 178
LweI GCATC 1 cut(s) 123
MaeI CTAG 1 cut(s) 202
MalI GATC 2 cut(s) 21, 42
MboI GATC 2 cut(s) 19, 40
MboII GAAGA 1 cut(s) 91
MflI RGATCY 1 cut(s) 40
MnlI CCTC 3 cut(s) 79, 109, 184
MseI TTAA 1 cut(s) 180
MspCI CTTAAG 1 cut(s) 179
MspR9I CCNGG 2 cut(s) 17, 60
MvaI CCWGG 2 cut(s) 17, 60
NdeII GATC 2 cut(s) 19, 40
NlaIII CATG 1 cut(s) 142
NlaIV GGNNCC 1 cut(s) 64
PfeI GAWTC 1 cut(s) 12
PfoI TCCNGGA 2 cut(s) 15, 58
Psp6I CCWGG 2 cut(s) 15, 58
PspGI CCWGG 2 cut(s) 15, 58
PspN4I GGNNCC 1 cut(s) 64
PsuI RGATCY 1 cut(s) 40
RsaI GTAC 1 cut(s) 185
RsaNI GTAC 1 cut(s) 184
SaqAI TTAA 1 cut(s) 180
Sau3AI GATC 2 cut(s) 19, 40
ScrFI CCNGG 2 cut(s) 17, 60
SetI ASST 2 cut(s) 90, 170
SfaNI GCATC 1 cut(s) 123
SmlI CTYRAG 1 cut(s) 179
SmoI CTYRAG 1 cut(s) 179
SspMI CTAG 1 cut(s) 202
StyD4I CCNGG 2 cut(s) 15, 58
TatI WGTACW 1 cut(s) 183
TfiI GAWTC 1 cut(s) 12
Tru1I TTAA 1 cut(s) 180
Tru9I TTAA 1 cut(s) 180
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 53
Vha464I CTTAAG 1 cut(s) 179
XcmI CCANNNNNNNNNTGG 1 cut(s) 43
XspI CTAG 1 cut(s) 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.