Rmu_sc0002327.1_g000008

F-box protein At3g07870-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002327.1
OG0012626
Physical Location & Seq
Reverse (-)
33711 .. 34157
447 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002327.1_g000008.1.cds

Sequence Viewer

Length: 447 bp
atgccttcagctccacaatctgatgagtggaaggcaatggtgctgacggttggctcaaagagttggagaaacattgggagttgtaagcgtcctggtagcctgcgagaagaggtgatttatttgaatggttttcttggttgctttgatcataagagttattcgattcatgcattcaacattgaaagtgagcggtttcaagagtttcaggtttctgctccgagagaatctagtagtcattgctttgacaggctgggactaggagtcttggaaggctgtctctccctaactgattttaagaagaatgatcgtgatgttgaaggtgtttgggtgatgaaggattatggtgttaaagagtcttggaccaaagagtttgaaattagagaatcgtgtgaactacaacgtacccttgaaatttacagaaggaaaatttattgtggtatgttatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box FBA_1

Protein Analysis

148

Amino Acids

17.16

Weight (kDa)

6.32

Isoelectric Point (pI)

56.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 190
AciI CCGC 1 cut(s) 190
AcsI RAATTY 2 cut(s) 411, 426
AfaI GTAC 1 cut(s) 403
AgsI TTSAA 7 cut(s) 124, 175, 182, 197, 317, 374, 410
AhdI GACNNNNNGTC 1 cut(s) 260
AjnI CCWGG 1 cut(s) 91
AluBI AGCT 1 cut(s) 11
AluI AGCT 1 cut(s) 11
Alw26I GTCTC 1 cut(s) 281
ApoI RAATTY 2 cut(s) 411, 426
AspS9I GGNCC 1 cut(s) 360
AsuHPI GGTGA 2 cut(s) 124, 340
AvaII GGWCC 1 cut(s) 360
BciT130I CCWGG 1 cut(s) 93
BclI TGATCA 1 cut(s) 145
BcoDI GTCTC 1 cut(s) 281
BfaI CTAG 2 cut(s) 228, 257
Bme1390I CCNGG 1 cut(s) 93
Bme18I GGWCC 1 cut(s) 360
BmeRI GACNNNNNGTC 1 cut(s) 260
BmgT120I GGNCC 1 cut(s) 360
BmrFI CCNGG 1 cut(s) 93
Bse3DI GCAATG 2 cut(s) 42, 235
BseBI CCWGG 1 cut(s) 93
BseMI GCAATG 2 cut(s) 42, 235
BseYI CCCAGC 1 cut(s) 250
BslFI GGGAC 1 cut(s) 267
BsmAI GTCTC 1 cut(s) 281
BsmFI GGGAC 1 cut(s) 267
BsmI GAATGC 1 cut(s) 170
Bsp143I GATC 2 cut(s) 145, 304
BspACI CCGC 1 cut(s) 190
BsrBI CCGCTC 1 cut(s) 190
BsrDI GCAATG 2 cut(s) 42, 235
BssMI GATC 2 cut(s) 145, 304
Bst2UI CCWGG 1 cut(s) 93
Bst4CI ACNGT 1 cut(s) 49
Bst6I CTCTTC 1 cut(s) 102
BstC8I GCNNGC 1 cut(s) 101
BstKTI GATC 2 cut(s) 148, 307
BstMAI GTCTC 1 cut(s) 281
BstMBI GATC 2 cut(s) 145, 304
BstNI CCWGG 1 cut(s) 93
BstSCI CCNGG 1 cut(s) 91
Cac8I GCNNGC 1 cut(s) 101
Cfr13I GGNCC 1 cut(s) 360
CseI GACGC 1 cut(s) 77
Csp6I GTAC 1 cut(s) 402
CviAII CATG 1 cut(s) 167
CviJI RGCY 5 cut(s) 11, 54, 99, 250, 273
CviKI_1 RGCY 5 cut(s) 11, 54, 99, 250, 273
CviQI GTAC 1 cut(s) 402
DpnI GATC 2 cut(s) 147, 306
DpnII GATC 2 cut(s) 145, 304
DriI GACNNNNNGTC 1 cut(s) 260
Eam1104I CTCTTC 1 cut(s) 102
Eam1105I GACNNNNNGTC 1 cut(s) 260
EarI CTCTTC 1 cut(s) 102
Eco47I GGWCC 1 cut(s) 360
EcoRII CCWGG 1 cut(s) 91
EcoT22I ATGCAT 1 cut(s) 172
FaeI CATG 1 cut(s) 170
FaiI YATR 5 cut(s) 150, 168, 342, 440, 445
FaqI GGGAC 1 cut(s) 267
FatI CATG 1 cut(s) 166
FbaI TGATCA 1 cut(s) 145
FspBI CTAG 2 cut(s) 228, 257
GsaI CCCAGC 1 cut(s) 254
HgaI GACGC 1 cut(s) 77
Hin1II CATG 1 cut(s) 170
HinfI GANTC 5 cut(s) 163, 224, 261, 353, 383
HphI GGTGA 2 cut(s) 124, 340
Hpy166II GTNNAC 1 cut(s) 392
Hpy188I TCNGA 2 cut(s) 22, 219
Hpy188III TCNNGA 2 cut(s) 197, 308
Hpy8I GTNNAC 1 cut(s) 392
HpyAV CCTTC 6 cut(s) 15, 25, 263, 311, 328, 414
HpyCH4III ACNGT 1 cut(s) 49
HpyCH4IV ACGT 1 cut(s) 400
HpyCH4V TGCA 1 cut(s) 170
HpySE526I ACGT 1 cut(s) 400
Hsp92II CATG 1 cut(s) 170
Ksp22I TGATCA 1 cut(s) 145
Kzo9I GATC 2 cut(s) 145, 304
LmnI GCTCC 2 cut(s) 16, 220
LpnPI CCDG 6 cut(s) 78, 105, 113, 191, 232, 236
MaeI CTAG 2 cut(s) 228, 257
MaeII ACGT 1 cut(s) 400
MalI GATC 2 cut(s) 147, 306
MbiI CCGCTC 1 cut(s) 190
MboI GATC 2 cut(s) 145, 304
MboII GAAGA 2 cut(s) 119, 310
MluCI AATT 3 cut(s) 375, 411, 426
MlyI GAGTC 2 cut(s) 270, 362
MmeI TCCRAC 1 cut(s) 44
MnlI CCTC 1 cut(s) 103
Mph1103I ATGCAT 1 cut(s) 172
MseI TTAA 2 cut(s) 294, 348
MspR9I CCNGG 1 cut(s) 93
Mva1269I GAATGC 1 cut(s) 170
MvaI CCWGG 1 cut(s) 93
NdeII GATC 2 cut(s) 145, 304
NlaIII CATG 1 cut(s) 170
NsiI ATGCAT 1 cut(s) 172
PctI GAATGC 1 cut(s) 170
PfeI GAWTC 3 cut(s) 163, 224, 383
PleI GAGTC 2 cut(s) 269, 361
PpsI GAGTC 2 cut(s) 269, 361
Psp6I CCWGG 1 cut(s) 91
PspFI CCCAGC 1 cut(s) 250
PspGI CCWGG 1 cut(s) 91
PspPI GGNCC 1 cut(s) 360
RsaI GTAC 1 cut(s) 403
RsaNI GTAC 1 cut(s) 402
SaqAI TTAA 2 cut(s) 294, 348
Sau3AI GATC 2 cut(s) 145, 304
Sau96I GGNCC 1 cut(s) 360
SchI GAGTC 2 cut(s) 270, 362
ScrFI CCNGG 1 cut(s) 93
SetI ASST 5 cut(s) 13, 114, 210, 322, 403
SinI GGWCC 1 cut(s) 360
Sse9I AATT 3 cut(s) 375, 411, 426
SsiI CCGC 1 cut(s) 190
SspMI CTAG 2 cut(s) 228, 257
StyD4I CCNGG 1 cut(s) 91
TaaI ACNGT 1 cut(s) 49
TaiI ACGT 1 cut(s) 403
TaqI TCGA 1 cut(s) 161
TasI AATT 3 cut(s) 375, 411, 426
TfiI GAWTC 3 cut(s) 163, 224, 383
Tru1I TTAA 2 cut(s) 294, 348
Tru9I TTAA 2 cut(s) 294, 348
TspDTI ATGAA 2 cut(s) 155, 347
VpaK11BI GGWCC 1 cut(s) 360
XapI RAATTY 2 cut(s) 411, 426
XspI CTAG 2 cut(s) 228, 257
Zsp2I ATGCAT 1 cut(s) 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.