RLG00000006355

F-box protein At3g07870-like

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
Physical Location & Seq
Reverse (-)
6480505 .. 6481100
596 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000006355

Sequence Viewer

Length: 516 bp
ATGCCTTCAGCTTCACAATCTGATGAGTGGAAGGCAATGGTGCTGACGGTTGGCTCAAAGAGTTGGAGAAGCATAGGGAGTTGTAAGCGTCCTGGTAGCCTGCGAGAAGAGATGATTTATTTGAATGGTTTTCTTCATTGCTTTGATCATAAGCGTTATTCAATTCATGCATTCGACATTGAAAGTGAGCGGTTTCAACAGTTTCAGGTTTCTGCTCTGAGAGAATCTAGTAGTCATTGCTTTGACAGGCTGGGACTAGAAGTCTTGGAAGGCTGTCTCTCCTCAACTGATTTTAAGAAGAATGATCGTGATGTTGAAGAAGGAAAATTTATTGTGGTATGTTATGATCGAGTTTATGGAATAAGTTTGATGGCTTATACTCCTGGAACAAGGAGCATTGAGAGGATTGAGGCAGTTGGTATGGGGTGGGACAGTTTTAAGCGGATTCGGTTCAAAAGCATAAGGCTCTTTGTTCCAAACTTGGTTTCGCTCAAGGATATCCTCGGAGTTAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

172

Amino Acids

19.59

Weight (kDa)

8.28

Isoelectric Point (pI)

52.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 190
AciI CCGC 2 cut(s) 190, 442
AcsI RAATTY 1 cut(s) 326
AgsI TTSAA 6 cut(s) 124, 162, 182, 197, 317, 454
AhdI GACNNNNNGTC 1 cut(s) 260
AjnI CCWGG 2 cut(s) 91, 382
AjuI GAANNNNNNNTTGG 2 cut(s) 469, 501
AluBI AGCT 2 cut(s) 11, 513
AluI AGCT 2 cut(s) 11, 513
Alw26I GTCTC 1 cut(s) 281
ApoI RAATTY 1 cut(s) 326
BccI CCATC 1 cut(s) 364
BciT130I CCWGG 2 cut(s) 93, 384
BclI TGATCA 1 cut(s) 145
BcoDI GTCTC 1 cut(s) 281
BfaI CTAG 3 cut(s) 228, 257, 514
Bme1390I CCNGG 2 cut(s) 93, 384
BmeRI GACNNNNNGTC 1 cut(s) 260
BmrFI CCNGG 2 cut(s) 93, 384
BpuEI CTTGAG 1 cut(s) 476
BsaJI CCNNGG 1 cut(s) 502
Bse3DI GCAATG 3 cut(s) 42, 136, 235
BseBI CCWGG 2 cut(s) 93, 384
BseDI CCNNGG 1 cut(s) 502
BseMI GCAATG 3 cut(s) 42, 136, 235
BseMII CTCAG 1 cut(s) 209
BseRI GAGGAG 1 cut(s) 271
BseYI CCCAGC 1 cut(s) 250
BslFI GGGAC 2 cut(s) 267, 443
BsmAI GTCTC 1 cut(s) 281
BsmFI GGGAC 2 cut(s) 267, 443
BsmI GAATGC 1 cut(s) 170
Bsp143I GATC 3 cut(s) 145, 304, 346
BspACI CCGC 2 cut(s) 190, 442
BspCNI CTCAG 1 cut(s) 210
BsrBI CCGCTC 1 cut(s) 190
BsrDI GCAATG 3 cut(s) 42, 136, 235
BssECI CCNNGG 1 cut(s) 502
BssMI GATC 3 cut(s) 145, 304, 346
Bst2UI CCWGG 2 cut(s) 93, 384
Bst4CI ACNGT 3 cut(s) 49, 201, 434
Bst6I CTCTTC 1 cut(s) 102
BstC8I GCNNGC 1 cut(s) 101
BstDEI CTNAG 1 cut(s) 218
BstKTI GATC 3 cut(s) 148, 307, 349
BstMAI GTCTC 1 cut(s) 281
BstMBI GATC 3 cut(s) 145, 304, 346
BstNI CCWGG 2 cut(s) 93, 384
BstSCI CCNGG 2 cut(s) 91, 382
Cac8I GCNNGC 1 cut(s) 101
CseI GACGC 1 cut(s) 77
CviAII CATG 1 cut(s) 167
CviJI RGCY 8 cut(s) 11, 54, 99, 250, 273, 374, 466, 513
CviKI_1 RGCY 8 cut(s) 11, 54, 99, 250, 273, 374, 466, 513
DdeI CTNAG 1 cut(s) 218
DpnI GATC 3 cut(s) 147, 306, 348
DpnII GATC 3 cut(s) 145, 304, 346
DriI GACNNNNNGTC 1 cut(s) 260
Eam1104I CTCTTC 1 cut(s) 102
Eam1105I GACNNNNNGTC 1 cut(s) 260
EarI CTCTTC 1 cut(s) 102
Eco32I GATATC 1 cut(s) 499
EcoRII CCWGG 2 cut(s) 91, 382
EcoRV GATATC 1 cut(s) 499
EcoT22I ATGCAT 1 cut(s) 172
FaeI CATG 1 cut(s) 170
FaiI YATR 9 cut(s) 74, 150, 168, 340, 345, 357, 378, 422, 461
FaqI GGGAC 2 cut(s) 267, 443
FatI CATG 1 cut(s) 166
FbaI TGATCA 1 cut(s) 145
FspBI CTAG 3 cut(s) 228, 257, 514
GsaI CCCAGC 1 cut(s) 254
HgaI GACGC 1 cut(s) 77
Hin1II CATG 1 cut(s) 170
HinfI GANTC 2 cut(s) 224, 445
Hpy188I TCNGA 3 cut(s) 22, 219, 506
Hpy188III TCNNGA 1 cut(s) 308
HpyAV CCTTC 4 cut(s) 15, 25, 263, 314
HpyCH4III ACNGT 3 cut(s) 49, 201, 434
HpyCH4V TGCA 1 cut(s) 170
HpyF3I CTNAG 1 cut(s) 218
Hsp92II CATG 1 cut(s) 170
Ksp22I TGATCA 1 cut(s) 145
Kzo9I GATC 3 cut(s) 145, 304, 346
LmnI GCTCC 1 cut(s) 393
LpnPI CCDG 8 cut(s) 78, 105, 113, 191, 232, 236, 369, 396
MaeI CTAG 3 cut(s) 228, 257, 514
MalI GATC 3 cut(s) 147, 306, 348
MbiI CCGCTC 1 cut(s) 190
MboI GATC 3 cut(s) 145, 304, 346
MboII GAAGA 4 cut(s) 119, 125, 310, 329
MluCI AATT 2 cut(s) 162, 326
MmeI TCCRAC 1 cut(s) 44
MnlI CCTC 4 cut(s) 292, 396, 403, 512
Mph1103I ATGCAT 1 cut(s) 172
MseI TTAA 2 cut(s) 294, 438
MspR9I CCNGG 2 cut(s) 93, 384
Mva1269I GAATGC 1 cut(s) 170
MvaI CCWGG 2 cut(s) 93, 384
NdeII GATC 3 cut(s) 145, 304, 346
NlaIII CATG 1 cut(s) 170
NsiI ATGCAT 1 cut(s) 172
PctI GAATGC 1 cut(s) 170
PfeI GAWTC 2 cut(s) 224, 445
PfoI TCCNGGA 1 cut(s) 382
Psp6I CCWGG 2 cut(s) 91, 382
PspFI CCCAGC 1 cut(s) 250
PspGI CCWGG 2 cut(s) 91, 382
SaqAI TTAA 2 cut(s) 294, 438
Sau3AI GATC 3 cut(s) 145, 304, 346
ScrFI CCNGG 2 cut(s) 93, 384
SetI ASST 3 cut(s) 13, 210, 515
SmlI CTYRAG 1 cut(s) 491
SmoI CTYRAG 1 cut(s) 491
Sse9I AATT 2 cut(s) 162, 326
SsiI CCGC 2 cut(s) 190, 442
SspMI CTAG 3 cut(s) 228, 257, 514
StyD4I CCNGG 2 cut(s) 91, 382
TaaI ACNGT 3 cut(s) 49, 201, 434
TaqI TCGA 2 cut(s) 174, 349
TasI AATT 2 cut(s) 162, 326
TfiI GAWTC 2 cut(s) 224, 445
Tru1I TTAA 2 cut(s) 294, 438
Tru9I TTAA 2 cut(s) 294, 438
TspDTI ATGAA 2 cut(s) 125, 155
XapI RAATTY 1 cut(s) 326
XspI CTAG 3 cut(s) 228, 257, 514
Zsp2I ATGCAT 1 cut(s) 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.