MD00G1150500.v1.1

kDa chaperonin

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Reverse (-)
33225667 .. 33228832
3166 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1150500.v1.1.491

Sequence Viewer

Length: 168 bp
ATGGGAACCCACCAAGCTGGAGGAGTTTTGCTGCCCAGGTCAGCTGTTAAATTTGAACGCTATCTTATGGGAGAAATTCTTTCTGTTGGTGCTGACGTTGGGGAAGTGAAGGCTGGAAAGAAGATGGGAGGCATTGCTTCTGCAAAGAGAGTGAATTATAGGCCATAG

Protein Analysis

56

Amino Acids

5.8

Weight (kDa)

10.11

Isoelectric Point (pI)

27.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 50, 75
AgsI TTSAA 1 cut(s) 56
AjnI CCWGG 1 cut(s) 35
AluBI AGCT 2 cut(s) 17, 44
AluI AGCT 2 cut(s) 17, 44
AoxI GGCC 1 cut(s) 161
ApeKI GCWGC 1 cut(s) 31
ApoI RAATTY 2 cut(s) 50, 75
BbvI GCAGC 1 cut(s) 18
BccI CCATC 1 cut(s) 118
BciT130I CCWGG 1 cut(s) 37
BisI GCNGC 1 cut(s) 32
BlsI GCNGC 1 cut(s) 33
Bme1390I CCNGG 1 cut(s) 37
BmiI GGNNCC 1 cut(s) 7
BmrFI CCNGG 1 cut(s) 37
BpmI CTGGAG 1 cut(s) 39
BsaJI CCNNGG 1 cut(s) 35
Bse3DI GCAATG 1 cut(s) 132
BseBI CCWGG 1 cut(s) 37
BseDI CCNNGG 1 cut(s) 35
BseMI GCAATG 1 cut(s) 132
BseRI GAGGAG 1 cut(s) 36
BseXI GCAGC 1 cut(s) 18
BshFI GGCC 1 cut(s) 163
BsnI GGCC 1 cut(s) 163
BspANI GGCC 1 cut(s) 163
BspLI GGNNCC 1 cut(s) 7
BsrDI GCAATG 1 cut(s) 132
BssECI CCNNGG 1 cut(s) 35
Bst2UI CCWGG 1 cut(s) 37
BstNI CCWGG 1 cut(s) 37
BstSCI CCNGG 1 cut(s) 35
BstV1I GCAGC 1 cut(s) 18
BstXI CCANNNNNNTGG 1 cut(s) 17
BsuRI GGCC 1 cut(s) 163
CviJI RGCY 4 cut(s) 17, 44, 113, 163
CviKI_1 RGCY 4 cut(s) 17, 44, 113, 163
EcoRII CCWGG 1 cut(s) 35
FaiI YATR 3 cut(s) 68, 159, 166
Fnu4HI GCNGC 1 cut(s) 32
Fsp4HI GCNGC 1 cut(s) 32
GluI GCNGC 1 cut(s) 32
GsuI CTGGAG 1 cut(s) 39
HaeIII GGCC 1 cut(s) 163
HpyAV CCTTC 1 cut(s) 103
HpyCH4IV ACGT 1 cut(s) 96
HpyCH4V TGCA 1 cut(s) 143
HpySE526I ACGT 1 cut(s) 96
LpnPI CCDG 4 cut(s) 3, 22, 49, 99
Lsp1109I GCAGC 1 cut(s) 18
MaeII ACGT 1 cut(s) 96
MboII GAAGA 1 cut(s) 133
MluCI AATT 3 cut(s) 50, 75, 154
MnlI CCTC 2 cut(s) 14, 122
MseI TTAA 1 cut(s) 48
MspA1I CMGCKG 1 cut(s) 44
MspR9I CCNGG 1 cut(s) 37
MvaI CCWGG 1 cut(s) 37
NlaIV GGNNCC 1 cut(s) 7
PkrI GCNGC 1 cut(s) 33
Psp6I CCWGG 1 cut(s) 35
PspGI CCWGG 1 cut(s) 35
PspN4I GGNNCC 1 cut(s) 7
PvuII CAGCTG 1 cut(s) 44
SaqAI TTAA 1 cut(s) 48
SatI GCNGC 1 cut(s) 32
ScrFI CCNGG 1 cut(s) 37
SetI ASST 4 cut(s) 19, 41, 46, 99
SgeI CNNG 5 cut(s) 26, 30, 48, 49, 126
Sse9I AATT 3 cut(s) 50, 75, 154
StyD4I CCNGG 1 cut(s) 35
TaiI ACGT 1 cut(s) 99
TasI AATT 3 cut(s) 50, 75, 154
Tru1I TTAA 1 cut(s) 48
Tru9I TTAA 1 cut(s) 48
TseI GCWGC 1 cut(s) 31
XapI RAATTY 2 cut(s) 50, 75
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.