MD00G1220400.v1.1

Remorin, C-terminal region

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
OG0003813
Physical Location & Seq
Reverse (-)
51926139 .. 51926710
572 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1220400.v1.1.491

Sequence Viewer

Length: 174 bp
ATGGATAAAATCATGAACAAGTTGAGATCAGCTCAGAAGAAAGCGCAAGACATGAGAAGCTCAGTTTTAGACGACCAAGCACAAGTTGCAAGAACCTCACGCAAAGCTTTATCATTCCGAAGAACTTGTCATATGGGTTCTTTGAGCGGTTGTTTTACATGTCACGTTTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Remorin_C

Protein Analysis

58

Amino Acids

6.48

Weight (kDa)

10.21

Isoelectric Point (pI)

57.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Remorin_C PF03763 1 - 45 1.9e-06 Remorin, C-terminal region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 147
AciI CCGC 1 cut(s) 147
AflIII ACRYGT 1 cut(s) 158
AluBI AGCT 3 cut(s) 32, 60, 107
AluI AGCT 3 cut(s) 32, 60, 107
ArsI GACNNNNNNTTYG 2 cut(s) 112, 144
AspLEI GCGC 1 cut(s) 46
BplI GAGNNNNNCTC 2 cut(s) 16, 48
BseMII CTCAG 2 cut(s) 47, 75
Bsp143I GATC 1 cut(s) 26
BspACI CCGC 1 cut(s) 147
BspCNI CTCAG 2 cut(s) 46, 74
BspHI TCATGA 1 cut(s) 12
BsrBI CCGCTC 1 cut(s) 147
BssMI GATC 1 cut(s) 26
BstAPI GCANNNNNTGC 1 cut(s) 86
BstDEI CTNAG 2 cut(s) 33, 61
BstHHI GCGC 1 cut(s) 46
BstKTI GATC 1 cut(s) 29
BstMBI GATC 1 cut(s) 26
BstMWI GCNNNNNNNGC 1 cut(s) 86
BstNSI RCATGY 1 cut(s) 162
CciI TCATGA 1 cut(s) 12
CfoI GCGC 1 cut(s) 46
CviAII CATG 3 cut(s) 13, 52, 159
CviJI RGCY 3 cut(s) 32, 60, 107
CviKI_1 RGCY 3 cut(s) 32, 60, 107
DdeI CTNAG 2 cut(s) 33, 61
DpnI GATC 1 cut(s) 28
DpnII GATC 1 cut(s) 26
FaeI CATG 3 cut(s) 16, 55, 162
FaiI YATR 5 cut(s) 14, 53, 132, 134, 160
FatI CATG 3 cut(s) 12, 51, 158
FauNDI CATATG 1 cut(s) 132
FspEI CC 6 cut(s) 89, 109, 119, 120, 131, 132
GlaI GCGC 1 cut(s) 45
HhaI GCGC 1 cut(s) 46
Hin1II CATG 3 cut(s) 16, 55, 162
Hin6I GCGC 1 cut(s) 44
HinP1I GCGC 1 cut(s) 44
HindIII AAGCTT 1 cut(s) 105
Hpy188I TCNGA 3 cut(s) 36, 119, 173
Hpy188III TCNNGA 1 cut(s) 13
HpyCH4IV ACGT 1 cut(s) 165
HpyCH4V TGCA 1 cut(s) 89
HpyF10VI GCNNNNNNNGC 1 cut(s) 86
HpyF3I CTNAG 2 cut(s) 33, 61
HpySE526I ACGT 1 cut(s) 165
Hsp92II CATG 3 cut(s) 16, 55, 162
HspAI GCGC 1 cut(s) 44
Kzo9I GATC 1 cut(s) 26
MaeII ACGT 1 cut(s) 165
MaeIII GTNAC 1 cut(s) 161
MalI GATC 1 cut(s) 28
MbiI CCGCTC 1 cut(s) 147
MboI GATC 1 cut(s) 26
MboII GAAGA 2 cut(s) 49, 132
MnlI CCTC 1 cut(s) 106
MwoI GCNNNNNNNGC 1 cut(s) 86
NdeI CATATG 1 cut(s) 132
NdeII GATC 1 cut(s) 26
NlaIII CATG 3 cut(s) 16, 55, 162
NmuCI GTSAC 1 cut(s) 161
NspI RCATGY 1 cut(s) 162
PagI TCATGA 1 cut(s) 12
PciI ACATGT 1 cut(s) 158
PscI ACATGT 1 cut(s) 158
Sau3AI GATC 1 cut(s) 26
SetI ASST 5 cut(s) 34, 62, 98, 109, 168
SgeI CNNG 9 cut(s) 25, 31, 59, 64, 89, 95, 102, 111, 138
SsiI CCGC 1 cut(s) 147
TaiI ACGT 1 cut(s) 168
TseFI GTSAC 1 cut(s) 161
Tsp45I GTSAC 1 cut(s) 161
TspDTI ATGAA 1 cut(s) 29
XceI RCATGY 1 cut(s) 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.