MD01G1121200.v1.1

Belongs to the universal ribosomal protein uL23 family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
Physical Location & Seq
Forward (+)
23493811 .. 23495607
1797 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1121200.v1.1.491

Sequence Viewer

Length: 465 bp
ATGGCCCCCGCTAAAGTTGACAGCACGAAGAAAAGTGATCCCAAGGCTAAAGCCTTGAAGACTGCCAAGGCTGTGAAATCAGGTCCTGCTTTTAAGAAGAAGGCCAAGAAGATCAGGACATCCGTCACATTCCACAGGCCAAGGACATTGAAGAAGGAAAGGAACCCCAAGTATCCCCGCATCAGTGCAACACCAAGGAACAAATTGGACCATTACCAAATTCTCAAGTATCCATTGACCACTGAGTCTGCAATGAAAAAGATTGAGGACAACAACACCCTTGTTTTCATTGTTGACATCCGAGCTGACAAGAAGAAGATCAAGGATGCGGTGAAGAAGATGTACGACATTCAGACCAAGAAAGTGAACACCTTGATCAGGCCTGATGGAACGAAGAAGGCTTACGTCAGGTTGACACCGGACTATGATGCCTTGGATGTTGCCAACAAGATCGGGATCATTTAA

Protein Analysis

155

Amino Acids

17.51

Weight (kDa)

10.26

Isoelectric Point (pI)

26.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L23eN PF03939 14 - 63 1.3e-18 Ribosomal protein L23, N-terminal domain
Ribosomal_L23 PF00276 73 - 134 7.1e-14 Ribosomal protein L23
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 244
AciI CCGC 3 cut(s) 9, 178, 329
AclWI GGATC 2 cut(s) 32, 464
AcsI RAATTY 1 cut(s) 219
AfaI GTAC 1 cut(s) 344
AfiI CCNNNNNNNGG 1 cut(s) 378
AgsI TTSAA 2 cut(s) 58, 151
AluBI AGCT 1 cut(s) 305
AluI AGCT 1 cut(s) 305
AlwI GGATC 2 cut(s) 32, 464
AlwNI CAGNNNCTG 1 cut(s) 86
AoxI GGCC 4 cut(s) 3, 102, 137, 380
ApoI RAATTY 1 cut(s) 219
AspS9I GGNCC 3 cut(s) 4, 83, 208
AsuHPI GGTGA 1 cut(s) 343
AvaII GGWCC 2 cut(s) 83, 208
BarI GAAGNNNNNNTAC 4 cut(s) 326, 358, 386, 418
BbsI GAAGAC 1 cut(s) 65
BccI CCATC 1 cut(s) 380
BciVI GTATCC 2 cut(s) 183, 240
BclI TGATCA 1 cut(s) 375
BfuI GTATCC 2 cut(s) 183, 240
Bme18I GGWCC 2 cut(s) 83, 208
BmgT120I GGNCC 3 cut(s) 4, 83, 208
BmiI GGNNCC 2 cut(s) 6, 164
BmsI GCATC 3 cut(s) 189, 316, 418
BoxI GACNNNNGTC 1 cut(s) 122
BpiI GAAGAC 1 cut(s) 65
BpuEI CTTGAG 1 cut(s) 209
BsaBI GATNNNNATC 1 cut(s) 455
BsaJI CCNNGG 5 cut(s) 42, 66, 140, 194, 432
BsaWI WCCGGW 1 cut(s) 418
Bsc4I CCNNNNNNNGG 1 cut(s) 378
Bse3DI GCAATG 1 cut(s) 258
Bse8I GATNNNNATC 1 cut(s) 455
BseDI CCNNGG 5 cut(s) 42, 66, 140, 194, 432
BseGI GGATG 4 cut(s) 119, 297, 331, 442
BseJI GATNNNNATC 1 cut(s) 455
BseLI CCNNNNNNNGG 1 cut(s) 378
BseMI GCAATG 1 cut(s) 258
BseMII CTCAG 1 cut(s) 234
BshFI GGCC 4 cut(s) 5, 104, 139, 382
BsiSI CCGG 1 cut(s) 419
BslI CCNNNNNNNGG 1 cut(s) 378
BsnI GGCC 4 cut(s) 5, 104, 139, 382
Bsp143I GATC 6 cut(s) 37, 111, 318, 375, 450, 456
BspACI CCGC 3 cut(s) 9, 178, 329
BspANI GGCC 4 cut(s) 5, 104, 139, 382
BspCNI CTCAG 1 cut(s) 235
BspLI GGNNCC 2 cut(s) 6, 164
BspPI GGATC 2 cut(s) 32, 464
BsrDI GCAATG 1 cut(s) 258
BssECI CCNNGG 5 cut(s) 42, 66, 140, 194, 432
BssMI GATC 6 cut(s) 37, 111, 318, 375, 450, 456
BssT1I CCWWGG 5 cut(s) 42, 66, 140, 194, 432
BstDEI CTNAG 1 cut(s) 243
BstENI CCTNNNNNAGG 1 cut(s) 376
BstF5I GGATG 4 cut(s) 119, 297, 331, 442
BstKTI GATC 6 cut(s) 40, 114, 321, 378, 453, 459
BstMBI GATC 6 cut(s) 37, 111, 318, 375, 450, 456
BstPAI GACNNNNGTC 1 cut(s) 122
BstV2I GAAGAC 1 cut(s) 65
BsuI GTATCC 2 cut(s) 183, 240
BsuRI GGCC 4 cut(s) 5, 104, 139, 382
BtsCI GGATG 4 cut(s) 119, 297, 331, 442
BtsIMutI CAGTG 2 cut(s) 190, 240
CaiI CAGNNNCTG 1 cut(s) 86
Cfr13I GGNCC 3 cut(s) 4, 83, 208
Csp6I GTAC 1 cut(s) 343
CviJI RGCY 9 cut(s) 5, 47, 53, 71, 104, 139, 305, 382, 401
CviKI_1 RGCY 9 cut(s) 5, 47, 53, 71, 104, 139, 305, 382, 401
CviQI GTAC 1 cut(s) 343
DdeI CTNAG 1 cut(s) 243
DpnI GATC 6 cut(s) 39, 113, 320, 377, 452, 458
DpnII GATC 6 cut(s) 37, 111, 318, 375, 450, 456
DrdI GACNNNNNNGTC 1 cut(s) 244
DseDI GACNNNNNNGTC 1 cut(s) 244
Eco130I CCWWGG 5 cut(s) 42, 66, 140, 194, 432
Eco147I AGGCCT 1 cut(s) 382
Eco47I GGWCC 2 cut(s) 83, 208
EcoNI CCTNNNNNAGG 1 cut(s) 376
EcoO109I RGGNCCY 1 cut(s) 83
EcoT14I CCWWGG 5 cut(s) 42, 66, 140, 194, 432
ErhI CCWWGG 5 cut(s) 42, 66, 140, 194, 432
FaiI YATR 1 cut(s) 426
FauI CCCGC 2 cut(s) 16, 185
FbaI TGATCA 1 cut(s) 375
FokI GGATG 4 cut(s) 106, 284, 338, 449
HaeIII GGCC 4 cut(s) 5, 104, 139, 382
HapII CCGG 1 cut(s) 419
HincII GTYRAC 3 cut(s) 19, 295, 414
HindII GTYRAC 3 cut(s) 19, 295, 414
HinfI GANTC 1 cut(s) 245
HpaII CCGG 1 cut(s) 419
HphI GGTGA 1 cut(s) 343
Hpy166II GTNNAC 4 cut(s) 19, 295, 367, 414
Hpy188I TCNGA 2 cut(s) 302, 354
Hpy188III TCNNGA 2 cut(s) 115, 454
Hpy8I GTNNAC 4 cut(s) 19, 295, 367, 414
HpyAV CCTTC 3 cut(s) 94, 148, 391
HpyCH4IV ACGT 1 cut(s) 405
HpyCH4V TGCA 2 cut(s) 188, 251
HpyF3I CTNAG 1 cut(s) 243
HpySE526I ACGT 1 cut(s) 405
Ksp22I TGATCA 1 cut(s) 375
Kzo9I GATC 6 cut(s) 37, 111, 318, 375, 450, 456
LpnPI CCDG 8 cut(s) 66, 99, 100, 121, 364, 394, 396, 432
LweI GCATC 3 cut(s) 189, 316, 418
MaeII ACGT 1 cut(s) 405
MaeIII GTNAC 1 cut(s) 124
MalI GATC 6 cut(s) 39, 113, 320, 377, 452, 458
MboI GATC 6 cut(s) 37, 111, 318, 375, 450, 456
MluCI AATT 2 cut(s) 203, 219
MlyI GAGTC 1 cut(s) 254
MnlI CCTC 1 cut(s) 259
MseI TTAA 2 cut(s) 93, 463
MspI CCGG 1 cut(s) 419
NdeII GATC 6 cut(s) 37, 111, 318, 375, 450, 456
NlaIV GGNNCC 2 cut(s) 6, 164
NmuCI GTSAC 1 cut(s) 124
PceI AGGCCT 1 cut(s) 382
PleI GAGTC 1 cut(s) 253
PpsI GAGTC 1 cut(s) 253
PpuMI RGGWCCY 1 cut(s) 83
PshAI GACNNNNGTC 1 cut(s) 122
Psp5II RGGWCCY 1 cut(s) 83
PspN4I GGNNCC 2 cut(s) 6, 164
PspPI GGNCC 3 cut(s) 4, 83, 208
PspPPI RGGWCCY 1 cut(s) 83
PstNI CAGNNNCTG 1 cut(s) 86
RsaI GTAC 1 cut(s) 344
RsaNI GTAC 1 cut(s) 343
SaqAI TTAA 2 cut(s) 93, 463
Sau3AI GATC 6 cut(s) 37, 111, 318, 375, 450, 456
Sau96I GGNCC 3 cut(s) 4, 83, 208
SchI GAGTC 1 cut(s) 254
SetI ASST 5 cut(s) 85, 307, 374, 408, 413
SfaNI GCATC 3 cut(s) 189, 316, 418
SinI GGWCC 2 cut(s) 83, 208
SmlI CTYRAG 1 cut(s) 224
SmoI CTYRAG 1 cut(s) 224
Sse9I AATT 2 cut(s) 203, 219
SseBI AGGCCT 1 cut(s) 382
SsiI CCGC 3 cut(s) 9, 178, 329
StuI AGGCCT 1 cut(s) 382
StyI CCWWGG 5 cut(s) 42, 66, 140, 194, 432
TaiI ACGT 1 cut(s) 408
TasI AATT 2 cut(s) 203, 219
Tru1I TTAA 2 cut(s) 93, 463
Tru9I TTAA 2 cut(s) 93, 463
TscAI CASTG 2 cut(s) 190, 247
TseFI GTSAC 1 cut(s) 124
Tsp45I GTSAC 1 cut(s) 124
TspDTI ATGAA 2 cut(s) 269, 277
TspGWI ACGGA 1 cut(s) 112
TspRI CASTG 2 cut(s) 190, 247
VpaK11BI GGWCC 2 cut(s) 83, 208
XagI CCTNNNNNAGG 1 cut(s) 376
XapI RAATTY 1 cut(s) 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.