MD02G1268800.v1.1

tRNA-dihydrouridine20 synthase activity

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
Physical Location & Seq
Reverse (-)
32338765 .. 32339740
976 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1268800.v1.1.491

Sequence Viewer

Length: 243 bp
ATGCGGGGATATGGTAGAGATGAATTCCATCAATCAGTCAAAGAATATGATGATTTTGAGGACAGGGTGAGATACGGGGAAGCGGAGGAAGGAAAAGAAGATACAAAGCGCACCAAGGTAACAGTGGCACGTCTTGAGTTTAGACAGTGTTTGAAAGAACAACAAAGAAAGAAGTTTGAGACGGATGGTGGTTCTTCTCGAGACAAGTCCTATGAAAAGAAGAAGCTACCCTATGATAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

9.66

Weight (kDa)

8.64

Isoelectric Point (pI)

32.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 4, 83
AcsI RAATTY 1 cut(s) 23
AgsI TTSAA 1 cut(s) 154
AjiI CACGTC 1 cut(s) 131
AluBI AGCT 1 cut(s) 226
AluI AGCT 1 cut(s) 226
Alw26I GTCTC 2 cut(s) 173, 195
Ama87I CYCGRG 1 cut(s) 198
ApoI RAATTY 1 cut(s) 23
AspLEI GCGC 1 cut(s) 111
AsuHPI GGTGA 1 cut(s) 79
AvaI CYCGRG 1 cut(s) 198
BccI CCATC 2 cut(s) 36, 179
BcoDI GTCTC 2 cut(s) 173, 195
BmeT110I CYCGRG 1 cut(s) 198
BmgBI CACGTC 1 cut(s) 131
BpuEI CTTGAG 1 cut(s) 155
BsaJI CCNNGG 1 cut(s) 114
BseDI CCNNGG 1 cut(s) 114
BseGI GGATG 1 cut(s) 190
BsiHKCI CYCGRG 1 cut(s) 198
BsmAI GTCTC 2 cut(s) 173, 195
BsmBI CGTCTC 1 cut(s) 173
BsoBI CYCGRG 1 cut(s) 198
BspACI CCGC 2 cut(s) 4, 83
BssECI CCNNGG 1 cut(s) 114
BssT1I CCWWGG 1 cut(s) 114
Bst4CI ACNGT 2 cut(s) 124, 147
BstF5I GGATG 1 cut(s) 190
BstHHI GCGC 1 cut(s) 111
BstMAI GTCTC 2 cut(s) 173, 195
BtrI CACGTC 1 cut(s) 131
BtsCI GGATG 1 cut(s) 190
BtsIMutI CAGTG 2 cut(s) 129, 152
CfoI GCGC 1 cut(s) 111
CviJI RGCY 1 cut(s) 226
CviKI_1 RGCY 1 cut(s) 226
Eco130I CCWWGG 1 cut(s) 114
Eco88I CYCGRG 1 cut(s) 198
EcoRI GAATTC 1 cut(s) 23
EcoT14I CCWWGG 1 cut(s) 114
ErhI CCWWGG 1 cut(s) 114
Esp3I CGTCTC 1 cut(s) 173
FaiI YATR 4 cut(s) 12, 48, 213, 234
FokI GGATG 1 cut(s) 197
GlaI GCGC 1 cut(s) 110
HhaI GCGC 1 cut(s) 111
Hin6I GCGC 1 cut(s) 109
HinP1I GCGC 1 cut(s) 109
HphI GGTGA 1 cut(s) 79
Hpy188III TCNNGA 3 cut(s) 134, 198, 200
HpyAV CCTTC 1 cut(s) 83
HpyCH4III ACNGT 2 cut(s) 124, 147
HpyCH4IV ACGT 1 cut(s) 130
HpySE526I ACGT 1 cut(s) 130
HspAI GCGC 1 cut(s) 109
LpnPI CCDG 1 cut(s) 49
MaeII ACGT 1 cut(s) 130
MaeIII GTNAC 1 cut(s) 118
MboII GAAGA 3 cut(s) 110, 186, 232
MluCI AATT 1 cut(s) 23
MnlI CCTC 2 cut(s) 52, 79
PaeR7I CTCGAG 1 cut(s) 198
SetI ASST 3 cut(s) 120, 133, 228
Sfr274I CTCGAG 1 cut(s) 198
SgeI CNNG 9 cut(s) 17, 76, 88, 127, 141, 146, 210, 212, 217
SlaI CTCGAG 1 cut(s) 198
SmlI CTYRAG 2 cut(s) 134, 198
SmoI CTYRAG 2 cut(s) 134, 198
Sse9I AATT 1 cut(s) 23
SsiI CCGC 2 cut(s) 4, 83
StyI CCWWGG 1 cut(s) 114
TaaI ACNGT 2 cut(s) 124, 147
TaiI ACGT 1 cut(s) 133
TaqI TCGA 1 cut(s) 199
TasI AATT 1 cut(s) 23
TscAI CASTG 2 cut(s) 129, 152
TspDTI ATGAA 2 cut(s) 36, 228
TspGWI ACGGA 1 cut(s) 197
TspRI CASTG 2 cut(s) 129, 152
XapI RAATTY 1 cut(s) 23
XcmI CCANNNNNNNNNTGG 1 cut(s) 121
XhoI CTCGAG 1 cut(s) 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.