MD05G1006700.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0016944
Physical Location & Seq
Reverse (-)
1636232 .. 1636946
715 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1006700.v1.1.491

Sequence Viewer

Length: 183 bp
ATGAATGACAGCAAATGCTCTCCTTTGTTATCATGCAAAGGAGTTAGTCAGTATGCATCTAAGCTTAAGTTCTGGAGATTTTTAGATGGGTTGTCTTGTCAAAACTCGAATTATGAAGATGAGTTAGTTGACAAGACAGGTGCTAGACGAGCTGAGTTTTGCCTATTTTTGTACACTTTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

61

Amino Acids

6.89

Weight (kDa)

7.62

Isoelectric Point (pI)

38.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016944)

Species Orthologous Gene IDs
malus_domestica MD05G1006700.v1.1
pyrus_communis pycom13g18460 pycom16g15400
rosa_chinensis RchiOBHm_Chr1g0378821 RchiOBHm_Chr3g0486301
rosa_laevigata RLG00000015986
rosa_multiflora Rmu_co8445899.1_g000001
rosa_roxburghii Rroxscaffold_2G00152310
rosa_samantha Rh2AG042400 Rh2BG040900 Rh2DG041400 Rh2DG041500 Rh3AG274500 Rh4DG222600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 173
AflII CTTAAG 1 cut(s) 65
AluBI AGCT 2 cut(s) 64, 152
AluI AGCT 2 cut(s) 64, 152
BccI CCATC 1 cut(s) 80
BfaI CTAG 1 cut(s) 144
BfrI CTTAAG 1 cut(s) 65
BmsI GCATC 1 cut(s) 65
BpmI CTGGAG 1 cut(s) 94
BseMII CTCAG 1 cut(s) 144
Bsp1407I TGTACA 1 cut(s) 171
BspCNI CTCAG 1 cut(s) 145
BspTI CTTAAG 1 cut(s) 65
BsrGI TGTACA 1 cut(s) 171
BstAFI CTTAAG 1 cut(s) 65
BstAUI TGTACA 1 cut(s) 171
BstDEI CTNAG 2 cut(s) 60, 153
BstMWI GCNNNNNNNGC 1 cut(s) 149
Csp6I GTAC 1 cut(s) 172
CviAII CATG 1 cut(s) 33
CviJI RGCY 2 cut(s) 64, 152
CviKI_1 RGCY 2 cut(s) 64, 152
CviQI GTAC 1 cut(s) 172
DdeI CTNAG 2 cut(s) 60, 153
EcoT22I ATGCAT 1 cut(s) 58
FaeI CATG 1 cut(s) 36
FaiI YATR 3 cut(s) 34, 54, 114
FatI CATG 1 cut(s) 32
FspBI CTAG 1 cut(s) 144
FspEI CC 7 cut(s) 24, 36, 58, 72, 73, 123, 176
GsuI CTGGAG 1 cut(s) 94
Hin1II CATG 1 cut(s) 36
HincII GTYRAC 1 cut(s) 130
HindII GTYRAC 1 cut(s) 130
HindIII AAGCTT 1 cut(s) 62
Hpy166II GTNNAC 2 cut(s) 130, 174
Hpy188III TCNNGA 1 cut(s) 73
Hpy8I GTNNAC 2 cut(s) 130, 174
HpyCH4V TGCA 2 cut(s) 36, 56
HpyF10VI GCNNNNNNNGC 1 cut(s) 149
HpyF3I CTNAG 2 cut(s) 60, 153
Hsp92II CATG 1 cut(s) 36
LpnPI CCDG 2 cut(s) 58, 123
LweI GCATC 1 cut(s) 65
MaeI CTAG 1 cut(s) 144
MboII GAAGA 1 cut(s) 128
MluCI AATT 1 cut(s) 109
Mph1103I ATGCAT 1 cut(s) 58
MseI TTAA 1 cut(s) 66
MspCI CTTAAG 1 cut(s) 65
MwoI GCNNNNNNNGC 1 cut(s) 149
NlaIII CATG 1 cut(s) 36
NsiI ATGCAT 1 cut(s) 58
RsaI GTAC 1 cut(s) 173
RsaNI GTAC 1 cut(s) 172
SaqAI TTAA 1 cut(s) 66
SetI ASST 3 cut(s) 66, 142, 154
SfaNI GCATC 1 cut(s) 65
SgeI CNNG 8 cut(s) 45, 85, 108, 118, 145, 150, 156, 161
SmlI CTYRAG 1 cut(s) 65
SmoI CTYRAG 1 cut(s) 65
Sse9I AATT 1 cut(s) 109
SspMI CTAG 1 cut(s) 144
TaqI TCGA 1 cut(s) 107
TasI AATT 1 cut(s) 109
TatI WGTACW 1 cut(s) 171
Tru1I TTAA 1 cut(s) 66
Tru9I TTAA 1 cut(s) 66
TspDTI ATGAA 2 cut(s) 17, 129
Vha464I CTTAAG 1 cut(s) 65
XspI CTAG 1 cut(s) 144
Zsp2I ATGCAT 1 cut(s) 58
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.