RchiOBHm_Chr1g0378821

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
65133925 .. 65136482
2558 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ60220

Sequence Viewer

Length: 270 bp
ATGGGAGTTACAAAGAATGGTGGAGAATCTACACTTGGTTCATCAAGAGAGCTAATTCTCAATACCACCTACCTTAATTACAAAGGTATCAATTCGCATTTAGATGGAGATGCAAGGGTTGGTTTCAGATTCGGATCTAGAGGTGGGTTTTCTCCATTTTCACCCATGTATTGGATTTTGATTGAGGTTGAGTATTCGGAGGTGGGTTTCCTCTGTTTGGGAATATATTTGGATCTTGAAGGAGATGGGTTGTTTGAAACTGGGTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

9.78

Weight (kDa)

4.57

Isoelectric Point (pI)

36.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016944)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 171
AclWI GGATC 2 cut(s) 142, 240
AfiI CCNNNNNNNGG 2 cut(s) 171, 217
AgsI TTSAA 2 cut(s) 239, 257
AjuI GAANNNNNNNTTGG 2 cut(s) 18, 50
AluBI AGCT 1 cut(s) 52
AluI AGCT 1 cut(s) 52
AlwI GGATC 2 cut(s) 142, 240
AsuHPI GGTGA 1 cut(s) 153
BaeI ACNNNNGTAYC 2 cut(s) 70, 103
BccI CCATC 2 cut(s) 98, 239
BfaI CTAG 1 cut(s) 138
BmrI ACTGGG 1 cut(s) 270
BmsI GCATC 1 cut(s) 100
BmuI ACTGGG 1 cut(s) 270
BsaBI GATNNNNATC 1 cut(s) 133
Bsc4I CCNNNNNNNGG 2 cut(s) 171, 217
Bse1I ACTGG 1 cut(s) 265
Bse8I GATNNNNATC 1 cut(s) 133
BseJI GATNNNNATC 1 cut(s) 133
BseLI CCNNNNNNNGG 2 cut(s) 171, 217
BseNI ACTGG 1 cut(s) 265
BslI CCNNNNNNNGG 2 cut(s) 171, 217
Bsp143I GATC 2 cut(s) 134, 232
BspPI GGATC 2 cut(s) 142, 240
BsrI ACTGG 1 cut(s) 265
BssMI GATC 2 cut(s) 134, 232
BstKTI GATC 2 cut(s) 137, 235
BstMBI GATC 2 cut(s) 134, 232
BstX2I RGATCY 2 cut(s) 134, 232
BstYI RGATCY 2 cut(s) 134, 232
CviAII CATG 1 cut(s) 166
CviJI RGCY 1 cut(s) 52
CviKI_1 RGCY 1 cut(s) 52
DpnI GATC 2 cut(s) 136, 234
DpnII GATC 2 cut(s) 134, 232
FaeI CATG 1 cut(s) 169
FaiI YATR 2 cut(s) 167, 226
FatI CATG 1 cut(s) 165
FspBI CTAG 1 cut(s) 138
Hin1II CATG 1 cut(s) 169
HinfI GANTC 2 cut(s) 26, 129
HphI GGTGA 1 cut(s) 153
Hpy188I TCNGA 3 cut(s) 128, 134, 199
Hpy188III TCNNGA 3 cut(s) 45, 138, 236
HpyAV CCTTC 1 cut(s) 233
HpyCH4V TGCA 1 cut(s) 113
Hsp92II CATG 1 cut(s) 169
Kzo9I GATC 2 cut(s) 134, 232
LpnPI CCDG 1 cut(s) 246
LweI GCATC 1 cut(s) 100
MaeI CTAG 1 cut(s) 138
MaeIII GTNAC 1 cut(s) 7
MalI GATC 2 cut(s) 136, 234
MboI GATC 2 cut(s) 134, 232
MflI RGATCY 2 cut(s) 134, 232
MluCI AATT 3 cut(s) 54, 76, 91
MnlI CCTC 4 cut(s) 134, 178, 193, 221
MseI TTAA 2 cut(s) 75, 268
MslI CAYNNNNRTG 1 cut(s) 102
NdeII GATC 2 cut(s) 134, 232
NlaIII CATG 1 cut(s) 169
PfeI GAWTC 2 cut(s) 26, 129
PflMI CCANNNNNTGG 1 cut(s) 171
PsuI RGATCY 2 cut(s) 134, 232
RseI CAYNNNNRTG 1 cut(s) 102
SaqAI TTAA 2 cut(s) 75, 268
Sau3AI GATC 2 cut(s) 134, 232
SetI ASST 7 cut(s) 54, 71, 75, 88, 145, 189, 204
SfaNI GCATC 1 cut(s) 100
SgeI CNNG 6 cut(s) 47, 57, 126, 150, 178, 248
SmiMI CAYNNNNRTG 1 cut(s) 102
Sse9I AATT 3 cut(s) 54, 76, 91
SspMI CTAG 1 cut(s) 138
TasI AATT 3 cut(s) 54, 76, 91
TfiI GAWTC 2 cut(s) 26, 129
Tru1I TTAA 2 cut(s) 75, 268
Tru9I TTAA 2 cut(s) 75, 268
TspDTI ATGAA 1 cut(s) 30
Van91I CCANNNNNTGG 1 cut(s) 171
XbaI TCTAGA 1 cut(s) 137
XspI CTAG 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.