RchiOBHm_Chr3g0486301

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
33174816 .. 33175090
275 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ45082

Sequence Viewer

Length: 192 bp
ATGGGAGTTACAAAGAATGGTGGAGAATCTACACTTGGTTCATCAAGAGAGCTAATTCTCAATACCACCTACCTTAATTACAAAGGTATCAATTCGCATTTAGATGGAGTTTTGATGGAGATGCAAGGGTTGGTTTCAGATTCGAATCTAGAGGTGGGTTTTCTCCATTTTCGCCCATGTATTGGATTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

6.86

Weight (kDa)

5.43

Isoelectric Point (pI)

15.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016944)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 182
AfiI CCNNNNNNNGG 1 cut(s) 182
AjuI GAANNNNNNNTTGG 2 cut(s) 18, 50
AluBI AGCT 1 cut(s) 52
AluI AGCT 1 cut(s) 52
AsuII TTCGAA 1 cut(s) 143
BaeI ACNNNNGTAYC 2 cut(s) 70, 103
BccI CCATC 2 cut(s) 98, 109
BfaI CTAG 1 cut(s) 149
BmsI GCATC 1 cut(s) 111
Bpu14I TTCGAA 1 cut(s) 143
BsaBI GATNNNNATC 1 cut(s) 144
Bsc4I CCNNNNNNNGG 1 cut(s) 182
Bse8I GATNNNNATC 1 cut(s) 144
BseJI GATNNNNATC 1 cut(s) 144
BseLI CCNNNNNNNGG 1 cut(s) 182
BslI CCNNNNNNNGG 1 cut(s) 182
Bsp119I TTCGAA 1 cut(s) 143
BspT104I TTCGAA 1 cut(s) 143
BstBI TTCGAA 1 cut(s) 143
CviAII CATG 1 cut(s) 177
CviJI RGCY 1 cut(s) 52
CviKI_1 RGCY 1 cut(s) 52
FaeI CATG 1 cut(s) 180
FaiI YATR 1 cut(s) 178
FatI CATG 1 cut(s) 176
FspBI CTAG 1 cut(s) 149
Hin1II CATG 1 cut(s) 180
HinfI GANTC 3 cut(s) 26, 140, 145
Hpy188I TCNGA 1 cut(s) 139
Hpy188III TCNNGA 2 cut(s) 45, 149
HpyCH4V TGCA 1 cut(s) 124
Hsp92II CATG 1 cut(s) 180
LweI GCATC 1 cut(s) 111
MaeI CTAG 1 cut(s) 149
MaeIII GTNAC 1 cut(s) 7
MluCI AATT 3 cut(s) 54, 76, 91
MnlI CCTC 1 cut(s) 145
MseI TTAA 1 cut(s) 75
MslI CAYNNNNRTG 1 cut(s) 102
NlaIII CATG 1 cut(s) 180
NspV TTCGAA 1 cut(s) 143
PfeI GAWTC 3 cut(s) 26, 140, 145
PflMI CCANNNNNTGG 1 cut(s) 182
RseI CAYNNNNRTG 1 cut(s) 102
SaqAI TTAA 1 cut(s) 75
SetI ASST 5 cut(s) 54, 71, 75, 88, 156
SfaNI GCATC 1 cut(s) 111
SfuI TTCGAA 1 cut(s) 143
SgeI CNNG 4 cut(s) 47, 57, 137, 161
SmiMI CAYNNNNRTG 1 cut(s) 102
Sse9I AATT 3 cut(s) 54, 76, 91
SspMI CTAG 1 cut(s) 149
TaqI TCGA 1 cut(s) 143
TasI AATT 3 cut(s) 54, 76, 91
TfiI GAWTC 3 cut(s) 26, 140, 145
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TspDTI ATGAA 1 cut(s) 30
Van91I CCANNNNNTGG 1 cut(s) 182
XbaI TCTAGA 1 cut(s) 148
XspI CTAG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.