MD05G1199900.v1.1

Mitochondrial protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0015778
Physical Location & Seq
Reverse (-)
32748279 .. 32750948
2670 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1199900.v1.1.491

Sequence Viewer

Length: 411 bp
ATGGTGCATCTTATCACACGACAGCTGATATTAATGCTTTGGCACAAGTCACTCCATTTGAAGACAAGGGAGATAGTGTATCAAGGAAAGAGTAGACCTAAAGAACTATTCCAGATTCCAGTAAAGCATCATACAAGGGGTTTACAGTTTACTTCAAATGTTCTAGAAGCTTACTTGGGCAAGGTTGTGAAGTCTAGCATTTGGCATCAAAGGTTAGGACACCCTGTTACTGAAATTATGTCTTCTATGTTAAAACAATCTGGGATTGTATCTAGTCCAGCTAATACATATATTATTTGTAGTTCTTGTATTCAGGGCAAAATGTCTAGGATTTCATTTCTAGTTAAGAGTGATAGGTGTGTGTCTCTATTTGAGAAAGTACACACTAATATTTGGGTTCATCTTCTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_2 Retrotran_gag_2

Protein Analysis

137

Amino Acids

15.69

Weight (kDa)

10.14

Isoelectric Point (pI)

48.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
gag_pre-integrs PF13976 63 - 108 2.5e-09 GAG-pre-integrase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 94
AfaI GTAC 1 cut(s) 381
AgsI TTSAA 2 cut(s) 61, 156
AluBI AGCT 3 cut(s) 25, 170, 281
AluI AGCT 3 cut(s) 25, 170, 281
Alw26I GTCTC 1 cut(s) 369
AseI ATTAAT 1 cut(s) 32
BbsI GAAGAC 2 cut(s) 68, 234
BcoDI GTCTC 1 cut(s) 369
BfaI CTAG 5 cut(s) 164, 195, 273, 327, 341
BmsI GCATC 3 cut(s) 16, 136, 214
BpiI GAAGAC 2 cut(s) 68, 234
BsaXI ACNNNNNCTCC 2 cut(s) 62, 92
Bse1I ACTGG 1 cut(s) 119
BseNI ACTGG 1 cut(s) 119
BsmAI GTCTC 1 cut(s) 369
BsrI ACTGG 1 cut(s) 119
Bst4CI ACNGT 1 cut(s) 147
BstMAI GTCTC 1 cut(s) 369
BstV2I GAAGAC 2 cut(s) 68, 234
Csp6I GTAC 1 cut(s) 380
CviJI RGCY 3 cut(s) 25, 170, 281
CviKI_1 RGCY 3 cut(s) 25, 170, 281
CviQI GTAC 1 cut(s) 380
FaiI YATR 5 cut(s) 132, 239, 248, 289, 291
FblI GTMKAC 1 cut(s) 94
FspBI CTAG 5 cut(s) 164, 195, 273, 327, 341
HindIII AAGCTT 1 cut(s) 168
HinfI GANTC 1 cut(s) 115
Hpy166II GTNNAC 4 cut(s) 95, 143, 150, 382
Hpy188III TCNNGA 2 cut(s) 112, 164
Hpy8I GTNNAC 4 cut(s) 95, 143, 150, 382
HpyCH4III ACNGT 1 cut(s) 147
HpyCH4V TGCA 1 cut(s) 7
LpnPI CCDG 6 cut(s) 125, 132, 237, 246, 291, 299
LweI GCATC 3 cut(s) 16, 136, 214
MaeI CTAG 5 cut(s) 164, 195, 273, 327, 341
MaeIII GTNAC 2 cut(s) 48, 226
MboII GAAGA 3 cut(s) 73, 234, 395
MluCI AATT 1 cut(s) 234
MseI TTAA 3 cut(s) 32, 251, 345
MspA1I CMGCKG 1 cut(s) 25
NmuCI GTSAC 1 cut(s) 48
PfeI GAWTC 1 cut(s) 115
PshBI ATTAAT 1 cut(s) 32
PvuII CAGCTG 1 cut(s) 25
RsaI GTAC 1 cut(s) 381
RsaNI GTAC 1 cut(s) 380
SaqAI TTAA 3 cut(s) 32, 251, 345
SetI ASST 7 cut(s) 27, 100, 172, 186, 215, 283, 359
SfaNI GCATC 3 cut(s) 16, 136, 214
Sse9I AATT 1 cut(s) 234
SspI AATATT 1 cut(s) 391
SspMI CTAG 5 cut(s) 164, 195, 273, 327, 341
TaaI ACNGT 1 cut(s) 147
TasI AATT 1 cut(s) 234
TatI WGTACW 1 cut(s) 379
TfiI GAWTC 1 cut(s) 115
Tru1I TTAA 3 cut(s) 32, 251, 345
Tru9I TTAA 3 cut(s) 32, 251, 345
TseFI GTSAC 1 cut(s) 48
Tsp45I GTSAC 1 cut(s) 48
TspDTI ATGAA 2 cut(s) 324, 389
VspI ATTAAT 1 cut(s) 32
XbaI TCTAGA 1 cut(s) 163
XmiI GTMKAC 1 cut(s) 94
XspI CTAG 5 cut(s) 164, 195, 273, 327, 341
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.