Basic Information

Type: gene

Biological Identity

Species

pyrus_communis

Chromosome

Chr17

Orthogroup ID

OG0015778

Physical Location & Seq

Genomic Coordinates Forward (+)

12111214 .. 12111750

Gene Structure 537 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

pycom17g14550.2

Sequence Viewer

CDS Protein Promoter (2k)

Length: 348 bp

ATGTCAATGCCTTGGCACAGGTTGCTCCATATGAAGGAAAGGAAAAGATCACTATTGCATAAGAAGACAAAGGAGATTCTGTATCAAGGAAAGAGTAGGCCTACGGAGTTGTTTCAGATCCCAGTTTTTCATAGTGCTAAAGGTCTGCAGTCTACAGTTGCGAATCCAACAGCTTTCCTTGGTCAAGTGGTGAAGTCAAGTGTGTGGCATCAAAGGTTGGGTCACCCTACAAATGAAGTAGGTCACCCTACAAATGAATTTCTTACTTGTATGCTAAAACAATGTAGTATATCGTATAATACAAACAATAAGAGTAGTGTAGTACCCTCAAAAATTTTAAATATATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

RVT_2 Retrotran_gag_2

Protein Analysis

116

Amino Acids

13.15

Weight (kDa)

10.21

Isoelectric Point (pI)

55.07

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015778)

Species	Orthologous Gene IDs
arabidopsis_thaliana	ATMG00710
malus_domestica	MD05G1199900.v1.1 MD06G1102500.v1.1 MD11G1090400.v1.1 MD14G1120600.v1.1
prunus_persica	Prupe.7G065900_v2.0.a1
pyrus_communis	pycom01g10770 pycom03g09220 pycom03g16680 pycom11g06850 pycom12g11180 pycom14g05450 pycom17g14550
rosa_chinensis	RchiOBHm_Chr4g0436251
rosa_wichuraiana	Rw1G008760

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	152
AclWI	GGATC	1 cut(s)	112
AcsI	RAATTY	2 cut(s)	257, 333
AfaI	GTAC	1 cut(s)	324
AfiI	CCNNNNNNNGG	1 cut(s)	34
AluBI	AGCT	1 cut(s)	173
AluI	AGCT	1 cut(s)	173
AlwI	GGATC	1 cut(s)	112
AoxI	GGCC	1 cut(s)	98
ApoI	RAATTY	2 cut(s)	257, 333
ArsI	GACNNNNNNTTYG	2 cut(s)	205, 237
AsuHPI	GGTGA	3 cut(s)	202, 215, 236
BbsI	GAAGAC	1 cut(s)	71
BfmI	CTRYAG	2 cut(s)	146, 153
BmrI	ACTGGG	1 cut(s)	116
BmsI	GCATC	1 cut(s)	217
BmuI	ACTGGG	1 cut(s)	116
BpiI	GAAGAC	1 cut(s)	71
BsaJI	CCNNGG	2 cut(s)	11, 178
BsaXI	ACNNNNNCTCC	2 cut(s)	65, 95
Bsc4I	CCNNNNNNNGG	1 cut(s)	34
Bse1I	ACTGG	1 cut(s)	122
BseDI	CCNNGG	2 cut(s)	11, 178
BseLI	CCNNNNNNNGG	1 cut(s)	34
BseNI	ACTGG	1 cut(s)	122
BshFI	GGCC	1 cut(s)	100
BslI	CCNNNNNNNGG	1 cut(s)	34
BsnI	GGCC	1 cut(s)	100
Bsp143I	GATC	2 cut(s)	47, 117
BspANI	GGCC	1 cut(s)	100
BspMAI	CTGCAG	1 cut(s)	150
BspPI	GGATC	1 cut(s)	112
BsrI	ACTGG	1 cut(s)	122
BssECI	CCNNGG	2 cut(s)	11, 178
BssMI	GATC	2 cut(s)	47, 117
BssT1I	CCWWGG	2 cut(s)	11, 178
Bst4CI	ACNGT	1 cut(s)	157
BstAPI	GCANNNNNTGC	1 cut(s)	22
BstEII	GGTNACC	2 cut(s)	221, 242
BstKTI	GATC	2 cut(s)	50, 120
BstMBI	GATC	2 cut(s)	47, 117
BstMWI	GCNNNNNNNGC	1 cut(s)	22
BstPI	GGTNACC	2 cut(s)	221, 242
BstSFI	CTRYAG	2 cut(s)	146, 153
BstV2I	GAAGAC	1 cut(s)	71
BstX2I	RGATCY	1 cut(s)	117
BstYI	RGATCY	1 cut(s)	117
BsuRI	GGCC	1 cut(s)	100
Csp6I	GTAC	1 cut(s)	323
CviJI	RGCY	2 cut(s)	100, 173
CviKI_1	RGCY	2 cut(s)	100, 173
CviQI	GTAC	1 cut(s)	323
DpnI	GATC	2 cut(s)	49, 119
DpnII	GATC	2 cut(s)	47, 117
DraI	TTTAAA	1 cut(s)	339
Eco130I	CCWWGG	2 cut(s)	11, 178
Eco147I	AGGCCT	1 cut(s)	100
Eco91I	GGTNACC	2 cut(s)	221, 242
EcoO65I	GGTNACC	2 cut(s)	221, 242
EcoT14I	CCWWGG	2 cut(s)	11, 178
ErhI	CCWWGG	2 cut(s)	11, 178
FaiI	YATR	9 cut(s)	30, 32, 60, 132, 272, 290, 297, 344, 346
FauNDI	CATATG	1 cut(s)	30
FblI	GTMKAC	1 cut(s)	152
HaeIII	GGCC	1 cut(s)	100
HinfI	GANTC	2 cut(s)	76, 163
HphI	GGTGA	3 cut(s)	202, 215, 236
Hpy166II	GTNNAC	1 cut(s)	153
Hpy188I	TCNGA	1 cut(s)	117
Hpy8I	GTNNAC	1 cut(s)	153
HpyAV	CCTTC	1 cut(s)	28
HpyCH4III	ACNGT	1 cut(s)	157
HpyCH4V	TGCA	2 cut(s)	58, 148
HpyF10VI	GCNNNNNNNGC	1 cut(s)	22
Kzo9I	GATC	2 cut(s)	47, 117
LmnI	GCTCC	1 cut(s)	30
LpnPI	CCDG	2 cut(s)	4, 135
LweI	GCATC	1 cut(s)	217
MaeIII	GTNAC	2 cut(s)	221, 242
MalI	GATC	2 cut(s)	49, 119
MboI	GATC	2 cut(s)	47, 117
MboII	GAAGA	1 cut(s)	76
MflI	RGATCY	1 cut(s)	117
MluCI	AATT	2 cut(s)	257, 333
MmeI	TCCRAC	1 cut(s)	191
MnlI	CCTC	1 cut(s)	337
MseI	TTAA	1 cut(s)	338
MwoI	GCNNNNNNNGC	1 cut(s)	22
NdeI	CATATG	1 cut(s)	30
NdeII	GATC	2 cut(s)	47, 117
NmuCI	GTSAC	2 cut(s)	221, 242
PceI	AGGCCT	1 cut(s)	100
PfeI	GAWTC	2 cut(s)	76, 163
PspEI	GGTNACC	2 cut(s)	221, 242
PstI	CTGCAG	1 cut(s)	150
PsuI	RGATCY	1 cut(s)	117
RsaI	GTAC	1 cut(s)	324
RsaNI	GTAC	1 cut(s)	323
SaqAI	TTAA	1 cut(s)	338
Sau3AI	GATC	2 cut(s)	47, 117
SetI	ASST	5 cut(s)	23, 145, 175, 218, 244
SfaNI	GCATC	1 cut(s)	217
SfcI	CTRYAG	2 cut(s)	146, 153
SgeI	CNNG	8 cut(s)	24, 31, 98, 134, 191, 197, 210, 279
Sse9I	AATT	2 cut(s)	257, 333
SseBI	AGGCCT	1 cut(s)	100
StuI	AGGCCT	1 cut(s)	100
StyI	CCWWGG	2 cut(s)	11, 178
TaaI	ACNGT	1 cut(s)	157
TasI	AATT	2 cut(s)	257, 333
TfiI	GAWTC	2 cut(s)	76, 163
Tru1I	TTAA	1 cut(s)	338
Tru9I	TTAA	1 cut(s)	338
TseFI	GTSAC	2 cut(s)	221, 242
Tsp45I	GTSAC	2 cut(s)	221, 242
TspDTI	ATGAA	4 cut(s)	47, 119, 249, 270
TspGWI	ACGGA	1 cut(s)	119
XapI	RAATTY	2 cut(s)	257, 333
XmiI	GTMKAC	1 cut(s)	152

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.