pycom03g09220

gag-polypeptide of LTR copia-type

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
OG0015778
Physical Location & Seq
Forward (+)
7688033 .. 7688706
674 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g09220.1

Sequence Viewer

Length: 501 bp
ATGGTGAAGGACAAAGCCACAGGGAGAATCTTGTTTAAGGGACTCTGCAACAATGGATTGTATCTCATTTCTTCATTTCCTGTCATTCCTCATATTCCTCAGAAACAAGCAAATCAAGTTGTTGCTTGTCTCGGACACACTGTCACCTCAAACTTGTGGCACTCCAGACTAGGTCATCCCTCCAATCTTATTGTTTCTCTTATACTTAGGAAATCTAATGTTGCTATTAATAAGGATGTGTCTTCTATAGTTTGTCAAAGTTGTCTAGAAGGCAAATTTAGTAAACTTCCTTTCTTTCCAACTACTTCCAAATCTGTAGTACCTTTTCAAGTTGTACATAGTGACCTATGGGGTCCTGCACCTTGTGTATCTGTGGATGGATTCAAATACTATGTCATATTTGTTGACGAATGTACCAGATTTTGCTGGCTGTTTCCTTTGCGAAATAAATCAGATTTTGTCTCTGTGTTTGTTTCCTTCTACCAATATGTTTTTACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Retrotran_gag_2 gag_pre-integrs

Protein Analysis

167

Amino Acids

18.67

Weight (kDa)

9.26

Isoelectric Point (pI)

48.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
gag_pre-integrs PF13976 20 - 92 8.1e-12 GAG-pre-integrase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 275
AdeI CACNNNGTG 1 cut(s) 365
AfaI GTAC 3 cut(s) 321, 336, 415
AgsI TTSAA 2 cut(s) 329, 385
AhdI GACNNNNNGTC 1 cut(s) 140
Alw26I GTCTC 2 cut(s) 134, 466
ApoI RAATTY 1 cut(s) 275
ArsI GACNNNNNNTTYG 2 cut(s) 378, 410
AseI ATTAAT 1 cut(s) 228
AspS9I GGNCC 1 cut(s) 353
AsuHPI GGTGA 2 cut(s) 16, 136
AvaII GGWCC 1 cut(s) 353
BaeI ACNNNNGTAYC 2 cut(s) 397, 430
BbsI GAAGAC 1 cut(s) 234
BccI CCATC 1 cut(s) 371
BcoDI GTCTC 2 cut(s) 134, 466
BfaI CTAG 2 cut(s) 170, 266
BfmI CTRYAG 2 cut(s) 246, 315
Bme18I GGWCC 1 cut(s) 353
BmeRI GACNNNNNGTC 1 cut(s) 140
BmgT120I GGNCC 1 cut(s) 353
BmiI GGNNCC 1 cut(s) 354
BpiI GAAGAC 1 cut(s) 234
BpmI CTGGAG 1 cut(s) 148
BseGI GGATG 3 cut(s) 175, 241, 382
BseMII CTCAG 1 cut(s) 113
BsgI GTGCAG 1 cut(s) 342
BslFI GGGAC 1 cut(s) 54
BsmAI GTCTC 2 cut(s) 134, 466
BsmFI GGGAC 1 cut(s) 54
Bsp1407I TGTACA 1 cut(s) 334
BspCNI CTCAG 1 cut(s) 112
BspLI GGNNCC 1 cut(s) 354
BsrGI TGTACA 1 cut(s) 334
Bst4CI ACNGT 1 cut(s) 142
BstAUI TGTACA 1 cut(s) 334
BstC8I GCNNGC 1 cut(s) 428
BstDEI CTNAG 2 cut(s) 99, 206
BstF5I GGATG 3 cut(s) 175, 241, 382
BstMAI GTCTC 2 cut(s) 134, 466
BstSFI CTRYAG 2 cut(s) 246, 315
BstV2I GAAGAC 1 cut(s) 234
BtsCI GGATG 3 cut(s) 175, 241, 382
BtsIMutI CAGTG 1 cut(s) 138
Cac8I GCNNGC 1 cut(s) 428
Cfr13I GGNCC 1 cut(s) 353
Csp6I GTAC 3 cut(s) 320, 335, 414
CviJI RGCY 2 cut(s) 17, 430
CviKI_1 RGCY 2 cut(s) 17, 430
CviQI GTAC 3 cut(s) 320, 335, 414
DdeI CTNAG 2 cut(s) 99, 206
DraIII CACNNNGTG 1 cut(s) 365
DriI GACNNNNNGTC 1 cut(s) 140
Eam1105I GACNNNNNGTC 1 cut(s) 140
Eco47I GGWCC 1 cut(s) 353
EcoO109I RGGNCCY 1 cut(s) 353
FaiI YATR 8 cut(s) 93, 203, 248, 339, 349, 393, 398, 489
FaqI GGGAC 1 cut(s) 54
FokI GGATG 3 cut(s) 162, 248, 389
FspBI CTAG 2 cut(s) 170, 266
GsuI CTGGAG 1 cut(s) 148
HincII GTYRAC 1 cut(s) 406
HindII GTYRAC 1 cut(s) 406
HinfI GANTC 3 cut(s) 27, 42, 381
HphI GGTGA 2 cut(s) 16, 136
Hpy166II GTNNAC 2 cut(s) 284, 406
Hpy188I TCNGA 3 cut(s) 102, 134, 454
Hpy188III TCNNGA 2 cut(s) 165, 266
Hpy8I GTNNAC 2 cut(s) 284, 406
HpyAV CCTTC 2 cut(s) 263, 487
HpyCH4III ACNGT 1 cut(s) 142
HpyCH4V TGCA 2 cut(s) 48, 359
HpyF3I CTNAG 2 cut(s) 99, 206
LpnPI CCDG 6 cut(s) 6, 93, 178, 369, 412, 430
MaeI CTAG 2 cut(s) 170, 266
MaeIII GTNAC 2 cut(s) 142, 341
MboII GAAGA 2 cut(s) 63, 234
MluCI AATT 1 cut(s) 275
MlyI GAGTC 1 cut(s) 36
MmeI TCCRAC 1 cut(s) 323
MnlI CCTC 4 cut(s) 99, 108, 157, 190
MseI TTAA 3 cut(s) 36, 228, 499
NlaIV GGNNCC 1 cut(s) 354
NmuCI GTSAC 2 cut(s) 142, 341
PfeI GAWTC 2 cut(s) 27, 381
PflFI GACNNNGTC 1 cut(s) 171
PleI GAGTC 1 cut(s) 36
PpsI GAGTC 1 cut(s) 36
PpuMI RGGWCCY 1 cut(s) 353
PshBI ATTAAT 1 cut(s) 228
Psp5II RGGWCCY 1 cut(s) 353
PspN4I GGNNCC 1 cut(s) 354
PspPI GGNCC 1 cut(s) 353
PspPPI RGGWCCY 1 cut(s) 353
PsyI GACNNNGTC 1 cut(s) 171
RsaI GTAC 3 cut(s) 321, 336, 415
RsaNI GTAC 3 cut(s) 320, 335, 414
SaqAI TTAA 3 cut(s) 36, 228, 499
Sau96I GGNCC 1 cut(s) 353
SchI GAGTC 1 cut(s) 36
SetI ASST 5 cut(s) 149, 175, 325, 348, 364
SfcI CTRYAG 2 cut(s) 246, 315
SinI GGWCC 1 cut(s) 353
Sse9I AATT 1 cut(s) 275
SspMI CTAG 2 cut(s) 170, 266
TaaI ACNGT 1 cut(s) 142
TasI AATT 1 cut(s) 275
TatI WGTACW 1 cut(s) 334
TfiI GAWTC 2 cut(s) 27, 381
Tru1I TTAA 3 cut(s) 36, 228, 499
Tru9I TTAA 3 cut(s) 36, 228, 499
TscAI CASTG 1 cut(s) 145
TseFI GTSAC 2 cut(s) 142, 341
Tsp45I GTSAC 2 cut(s) 142, 341
TspDTI ATGAA 1 cut(s) 63
TspRI CASTG 1 cut(s) 145
Tth111I GACNNNGTC 1 cut(s) 171
VpaK11BI GGWCC 1 cut(s) 353
VspI ATTAAT 1 cut(s) 228
XapI RAATTY 1 cut(s) 275
XbaI TCTAGA 1 cut(s) 265
XspI CTAG 2 cut(s) 170, 266
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.