MD05G1204500.v1.1

Signal-recognition-particle assembly has a crucial role in targeting secretory proteins to the rough endoplasmic reticulum membrane. SRP9 together with SRP14 and the Alu portion of the SRP RNA, constitutes the elongation arrest domain of SRP. The complex of SRP9 and SRP14 is required for SRP RNA binding

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
Physical Location & Seq
Reverse (-)
33410872 .. 33416690
5819 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1204500.v1.1.491

Sequence Viewer

Length: 312 bp
ATGGTCTACATAACTTCCTGGGACGAGTTCGTCGAGCGATCCGTCCAGCTTTTCCGCGCCGATCCCGAATCTACTCGATACGTGATGAAGTACCGGCATTGCGAGGGGAAATTGGTTCTTAAGGTTACTGATAATAAAGAGTGTCTGAAATTCAAAACAGACCAGGCGCAAGACGCTAAGAAGATGGAGAAACTCAACAACATATTCTTCACTTTGATGTCCCGAGGTCCTGAAGCGGATCCATCAGAAGTTACTGGGAAAGACCAGATGGACGCACAGCCGACCAAGAAAGGACGGGGAAGAAAACAATAG

Protein Analysis

104

Amino Acids

12.02

Weight (kDa)

9.12

Isoelectric Point (pI)

36.13

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SRP9-21 PF05486 5 - 66 2.5e-15 Signal recognition particle 9 kDa protein (SRP9)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012969)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G49100 AT3G49100
fragaria_vesca FvH4_2g22310
malus_domestica MD05G1204500.v1.1 MD10G1191500.v1.1
prunus_persica Prupe.8G230800_v2.0.a1
pyrus_communis pycom05g19080 pycom10g16510
rosa_chinensis RchiOBHm_Chr6g0289311
rosa_laevigata RLG00000012314
rosa_multiflora Rmu_sc0001527.1_g000023
rosa_roxburghii Rroxscaffold_7G00179350
rosa_rugosa Rorug06G0202600
rosa_samantha Rh6AG313500 Rh6BG321000 Rh6CG327200 Rh6DG312900
rosa_wichuraiana Rw6G027100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 29
AccI GTMKAC 1 cut(s) 6
AccII CGCG 1 cut(s) 57
AciI CCGC 2 cut(s) 55, 236
AclWI GGATC 4 cut(s) 33, 56, 233, 246
AcsI RAATTY 1 cut(s) 149
AcuI CTGAAG 1 cut(s) 252
AfaI GTAC 1 cut(s) 92
AflII CTTAAG 1 cut(s) 119
AgsI TTSAA 1 cut(s) 154
AjnI CCWGG 2 cut(s) 17, 162
AluBI AGCT 1 cut(s) 49
AluI AGCT 1 cut(s) 49
AlwI GGATC 4 cut(s) 33, 56, 233, 246
Ama87I CYCGRG 1 cut(s) 222
ApoI RAATTY 1 cut(s) 149
AspLEI GCGC 2 cut(s) 59, 169
AspS9I GGNCC 1 cut(s) 227
AvaI CYCGRG 1 cut(s) 222
AvaII GGWCC 1 cut(s) 227
BamHI GGATCC 1 cut(s) 238
BccI CCATC 3 cut(s) 178, 250, 262
BciT130I CCWGG 2 cut(s) 19, 164
BfrI CTTAAG 1 cut(s) 119
Bme1390I CCNGG 2 cut(s) 19, 164
Bme18I GGWCC 1 cut(s) 227
BmeT110I CYCGRG 1 cut(s) 222
BmgT120I GGNCC 1 cut(s) 227
BmiI GGNNCC 1 cut(s) 240
BmrFI CCNGG 2 cut(s) 19, 164
BmrI ACTGGG 1 cut(s) 264
BmuI ACTGGG 1 cut(s) 264
BsaAI YACGTR 1 cut(s) 82
BsaJI CCNNGG 2 cut(s) 18, 223
Bse118I RCCGGY 1 cut(s) 93
Bse1I ACTGG 1 cut(s) 259
Bse3DI GCAATG 1 cut(s) 97
BseBI CCWGG 2 cut(s) 19, 164
BseDI CCNNGG 2 cut(s) 18, 223
BseMI GCAATG 1 cut(s) 97
BseNI ACTGG 1 cut(s) 259
Bsh1236I CGCG 1 cut(s) 57
BsiHKCI CYCGRG 1 cut(s) 222
BsiSI CCGG 1 cut(s) 94
BslFI GGGAC 2 cut(s) 35, 205
BsmFI GGGAC 2 cut(s) 35, 205
BsoBI CYCGRG 1 cut(s) 222
Bsp143I GATC 3 cut(s) 38, 61, 238
BspACI CCGC 2 cut(s) 55, 236
BspFNI CGCG 1 cut(s) 57
BspLI GGNNCC 1 cut(s) 240
BspPI GGATC 4 cut(s) 33, 56, 233, 246
BspTI CTTAAG 1 cut(s) 119
BsrDI GCAATG 1 cut(s) 97
BsrFI RCCGGY 1 cut(s) 93
BsrI ACTGG 1 cut(s) 259
BssAI RCCGGY 1 cut(s) 93
BssECI CCNNGG 2 cut(s) 18, 223
BssMI GATC 3 cut(s) 38, 61, 238
Bst2UI CCWGG 2 cut(s) 19, 164
BstAFI CTTAAG 1 cut(s) 119
BstBAI YACGTR 1 cut(s) 82
BstDEI CTNAG 1 cut(s) 177
BstFNI CGCG 1 cut(s) 57
BstHHI GCGC 2 cut(s) 59, 169
BstKTI GATC 3 cut(s) 41, 64, 241
BstMBI GATC 3 cut(s) 38, 61, 238
BstMWI GCNNNNNNNGC 1 cut(s) 173
BstNI CCWGG 2 cut(s) 19, 164
BstSCI CCNGG 2 cut(s) 17, 162
BstUI CGCG 1 cut(s) 57
BstX2I RGATCY 1 cut(s) 238
BstYI RGATCY 1 cut(s) 238
CfoI GCGC 2 cut(s) 59, 169
Cfr10I RCCGGY 1 cut(s) 93
Cfr13I GGNCC 1 cut(s) 227
CseI GACGC 2 cut(s) 182, 281
Csp6I GTAC 1 cut(s) 91
CviJI RGCY 2 cut(s) 49, 280
CviKI_1 RGCY 2 cut(s) 49, 280
CviQI GTAC 1 cut(s) 91
DdeI CTNAG 1 cut(s) 177
DpnI GATC 3 cut(s) 40, 63, 240
DpnII GATC 3 cut(s) 38, 61, 238
DrdI GACNNNNNNGTC 1 cut(s) 29
DseDI GACNNNNNNGTC 1 cut(s) 29
Eco47I GGWCC 1 cut(s) 227
Eco57I CTGAAG 1 cut(s) 252
Eco88I CYCGRG 1 cut(s) 222
EcoO109I RGGNCCY 1 cut(s) 227
EcoRII CCWGG 2 cut(s) 17, 162
FaiI YATR 2 cut(s) 11, 203
FaqI GGGAC 2 cut(s) 35, 205
FblI GTMKAC 1 cut(s) 6
GlaI GCGC 2 cut(s) 58, 168
HapII CCGG 1 cut(s) 94
HgaI GACGC 2 cut(s) 182, 281
HhaI GCGC 2 cut(s) 59, 169
Hin6I GCGC 2 cut(s) 57, 167
HinP1I GCGC 2 cut(s) 57, 167
HinfI GANTC 1 cut(s) 68
HpaII CCGG 1 cut(s) 94
Hpy166II GTNNAC 1 cut(s) 7
Hpy188I TCNGA 2 cut(s) 147, 247
Hpy188III TCNNGA 3 cut(s) 65, 222, 230
Hpy8I GTNNAC 1 cut(s) 7
Hpy99I CGWCG 1 cut(s) 35
HpyCH4IV ACGT 1 cut(s) 81
HpyF10VI GCNNNNNNNGC 1 cut(s) 173
HpyF3I CTNAG 1 cut(s) 177
HpySE526I ACGT 1 cut(s) 81
HspAI GCGC 2 cut(s) 57, 167
Kzo9I GATC 3 cut(s) 38, 61, 238
LpnPI CCDG 9 cut(s) 4, 31, 59, 107, 149, 176, 240, 243, 278
MaeII ACGT 1 cut(s) 81
MaeIII GTNAC 2 cut(s) 124, 250
MalI GATC 3 cut(s) 40, 63, 240
MboI GATC 3 cut(s) 38, 61, 238
MboII GAAGA 3 cut(s) 193, 199, 312
MflI RGATCY 1 cut(s) 238
MluCI AATT 2 cut(s) 110, 149
MnlI CCTC 2 cut(s) 97, 218
MseI TTAA 1 cut(s) 120
MslI CAYNNNNRTG 1 cut(s) 215
MspCI CTTAAG 1 cut(s) 119
MspI CCGG 1 cut(s) 94
MspR9I CCNGG 2 cut(s) 19, 164
MvaI CCWGG 2 cut(s) 19, 164
MvnI CGCG 1 cut(s) 57
MwoI GCNNNNNNNGC 1 cut(s) 173
NdeII GATC 3 cut(s) 38, 61, 238
NlaIV GGNNCC 1 cut(s) 240
PcsI WCGNNNNNNNCGW 2 cut(s) 30, 39
PfeI GAWTC 1 cut(s) 68
Ppu21I YACGTR 1 cut(s) 82
PpuMI RGGWCCY 1 cut(s) 227
Psp5II RGGWCCY 1 cut(s) 227
Psp6I CCWGG 2 cut(s) 17, 162
PspGI CCWGG 2 cut(s) 17, 162
PspN4I GGNNCC 1 cut(s) 240
PspPI GGNCC 1 cut(s) 227
PspPPI RGGWCCY 1 cut(s) 227
PsuI RGATCY 1 cut(s) 238
RsaI GTAC 1 cut(s) 92
RsaNI GTAC 1 cut(s) 91
RseI CAYNNNNRTG 1 cut(s) 215
SaqAI TTAA 1 cut(s) 120
Sau3AI GATC 3 cut(s) 38, 61, 238
Sau96I GGNCC 1 cut(s) 227
ScrFI CCNGG 2 cut(s) 19, 164
SetI ASST 4 cut(s) 51, 84, 126, 229
SinI GGWCC 1 cut(s) 227
SmiMI CAYNNNNRTG 1 cut(s) 215
SmlI CTYRAG 1 cut(s) 119
SmoI CTYRAG 1 cut(s) 119
Sse9I AATT 2 cut(s) 110, 149
SsiI CCGC 2 cut(s) 55, 236
StyD4I CCNGG 2 cut(s) 17, 162
TaiI ACGT 1 cut(s) 84
TaqI TCGA 2 cut(s) 33, 76
TasI AATT 2 cut(s) 110, 149
TfiI GAWTC 1 cut(s) 68
Tru1I TTAA 1 cut(s) 120
Tru9I TTAA 1 cut(s) 120
TspDTI ATGAA 1 cut(s) 101
TspGWI ACGGA 1 cut(s) 31
Vha464I CTTAAG 1 cut(s) 119
VpaK11BI GGWCC 1 cut(s) 227
XapI RAATTY 1 cut(s) 149
XmiI GTMKAC 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.