Rh6BG321000

Signal-recognition-particle assembly has a crucial role in targeting secretory proteins to the rough endoplasmic reticulum membrane. SRP9 together with SRP14 and the Alu portion of the SRP RNA, constitutes the elongation arrest domain of SRP. The complex of SRP9 and SRP14 is required for SRP RNA binding

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
55206153 .. 55208650
2498 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG321000.1

Sequence Viewer

Length: 258 bp
ATGGTGTACGTTACGTCCTGGGACGAATTCGTCGAGCGATCCGTGCAGTTGTTCCGCAACGATCCTGATTCGACTCGGTATGTGATGAAGTACCGGCATTGCGATGGAAAGCTGGTTCTCAAAGTCACCGATAATAAAGAGTGTCTGAAATTTAAGACAGATCAGGCGCAGGATGCTAAGAAGATGGAGAAACTGAACAACATATTCTTCACCTTGATGGCCAGGGGTCCTGAAGGTATATCACATTATCTTTTTTGA

Protein Analysis

85

Amino Acids

10.12

Weight (kDa)

8.58

Isoelectric Point (pI)

37.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SRP9-21 PF05486 4 - 66 3.3e-15 Signal recognition particle 9 kDa protein (SRP9)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012969)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G49100 AT3G49100
fragaria_vesca FvH4_2g22310
malus_domestica MD05G1204500.v1.1 MD10G1191500.v1.1
prunus_persica Prupe.8G230800_v2.0.a1
pyrus_communis pycom05g19080 pycom10g16510
rosa_chinensis RchiOBHm_Chr6g0289311
rosa_laevigata RLG00000012314
rosa_multiflora Rmu_sc0001527.1_g000023
rosa_roxburghii Rroxscaffold_7G00179350
rosa_rugosa Rorug06G0202600
rosa_samantha Rh6AG313500 Rh6BG321000 Rh6CG327200 Rh6DG312900
rosa_wichuraiana Rw6G027100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 29
AciI CCGC 1 cut(s) 55
AclWI GGATC 2 cut(s) 33, 56
AcoI YGGCCR 1 cut(s) 219
AcsI RAATTY 2 cut(s) 26, 149
AcuI CTGAAG 1 cut(s) 252
AfaI GTAC 2 cut(s) 8, 92
AjnI CCWGG 2 cut(s) 17, 221
AloI GAACNNNNNNTCC 2 cut(s) 99, 131
AluBI AGCT 1 cut(s) 112
AluI AGCT 1 cut(s) 112
AlwI GGATC 2 cut(s) 33, 56
AoxI GGCC 1 cut(s) 219
ApoI RAATTY 2 cut(s) 26, 149
AspLEI GCGC 1 cut(s) 169
AspS9I GGNCC 1 cut(s) 227
AsuHPI GGTGA 2 cut(s) 118, 202
AvaII GGWCC 1 cut(s) 227
BalI TGGCCA 1 cut(s) 221
BccI CCATC 3 cut(s) 98, 178, 211
BciT130I CCWGG 2 cut(s) 19, 223
Bme1390I CCNGG 2 cut(s) 19, 223
Bme18I GGWCC 1 cut(s) 227
BmgT120I GGNCC 1 cut(s) 227
BmiI GGNNCC 1 cut(s) 228
BmrFI CCNGG 2 cut(s) 19, 223
BmsI GCATC 1 cut(s) 163
BsaJI CCNNGG 2 cut(s) 18, 222
Bse118I RCCGGY 1 cut(s) 93
Bse3DI GCAATG 1 cut(s) 97
BseBI CCWGG 2 cut(s) 19, 223
BseDI CCNNGG 2 cut(s) 18, 222
BseGI GGATG 1 cut(s) 178
BseMI GCAATG 1 cut(s) 97
BsgI GTGCAG 1 cut(s) 65
BshFI GGCC 1 cut(s) 221
BsiSI CCGG 1 cut(s) 94
BslFI GGGAC 1 cut(s) 35
BsmFI GGGAC 1 cut(s) 35
BsnI GGCC 1 cut(s) 221
Bsp143I GATC 3 cut(s) 38, 61, 160
BspACI CCGC 1 cut(s) 55
BspANI GGCC 1 cut(s) 221
BspLI GGNNCC 1 cut(s) 228
BspPI GGATC 2 cut(s) 33, 56
BsrDI GCAATG 1 cut(s) 97
BsrFI RCCGGY 1 cut(s) 93
BssAI RCCGGY 1 cut(s) 93
BssECI CCNNGG 2 cut(s) 18, 222
BssMI GATC 3 cut(s) 38, 61, 160
Bst2UI CCWGG 2 cut(s) 19, 223
BstDEI CTNAG 1 cut(s) 177
BstF5I GGATG 1 cut(s) 178
BstHHI GCGC 1 cut(s) 169
BstKTI GATC 3 cut(s) 41, 64, 163
BstMBI GATC 3 cut(s) 38, 61, 160
BstMWI GCNNNNNNNGC 2 cut(s) 43, 173
BstNI CCWGG 2 cut(s) 19, 223
BstSCI CCNGG 2 cut(s) 17, 221
BsuRI GGCC 1 cut(s) 221
BtgZI GCGATG 1 cut(s) 117
BtsCI GGATG 1 cut(s) 178
CfoI GCGC 1 cut(s) 169
Cfr10I RCCGGY 1 cut(s) 93
Cfr13I GGNCC 1 cut(s) 227
Csp6I GTAC 2 cut(s) 7, 91
CviJI RGCY 2 cut(s) 112, 221
CviKI_1 RGCY 2 cut(s) 112, 221
CviQI GTAC 2 cut(s) 7, 91
DdeI CTNAG 1 cut(s) 177
DpnI GATC 3 cut(s) 40, 63, 162
DpnII GATC 3 cut(s) 38, 61, 160
DrdI GACNNNNNNGTC 1 cut(s) 29
DseDI GACNNNNNNGTC 1 cut(s) 29
EaeI YGGCCR 1 cut(s) 219
Eco47I GGWCC 1 cut(s) 227
Eco57I CTGAAG 1 cut(s) 252
EcoO109I RGGNCCY 1 cut(s) 227
EcoRI GAATTC 1 cut(s) 26
EcoRII CCWGG 2 cut(s) 17, 221
FaiI YATR 3 cut(s) 81, 203, 239
FaqI GGGAC 1 cut(s) 35
FokI GGATG 1 cut(s) 185
GlaI GCGC 1 cut(s) 168
HaeIII GGCC 1 cut(s) 221
HapII CCGG 1 cut(s) 94
HhaI GCGC 1 cut(s) 169
Hin6I GCGC 1 cut(s) 167
HinP1I GCGC 1 cut(s) 167
HinfI GANTC 2 cut(s) 68, 73
HpaII CCGG 1 cut(s) 94
HphI GGTGA 2 cut(s) 118, 202
Hpy166II GTNNAC 1 cut(s) 7
Hpy188I TCNGA 1 cut(s) 147
Hpy188III TCNNGA 2 cut(s) 65, 230
Hpy8I GTNNAC 1 cut(s) 7
Hpy99I CGWCG 1 cut(s) 35
HpyAV CCTTC 1 cut(s) 227
HpyCH4IV ACGT 2 cut(s) 9, 14
HpyCH4V TGCA 1 cut(s) 46
HpyF10VI GCNNNNNNNGC 2 cut(s) 43, 173
HpyF3I CTNAG 1 cut(s) 177
HpySE526I ACGT 2 cut(s) 9, 14
HspAI GCGC 1 cut(s) 167
Kzo9I GATC 3 cut(s) 38, 61, 160
LweI GCATC 1 cut(s) 163
MaeII ACGT 2 cut(s) 9, 14
MaeIII GTNAC 2 cut(s) 10, 124
MalI GATC 3 cut(s) 40, 63, 162
MboI GATC 3 cut(s) 38, 61, 160
MboII GAAGA 2 cut(s) 193, 199
MlsI TGGCCA 1 cut(s) 221
MluCI AATT 2 cut(s) 26, 149
MluNI TGGCCA 1 cut(s) 221
MlyI GAGTC 1 cut(s) 67
Mox20I TGGCCA 1 cut(s) 221
MscI TGGCCA 1 cut(s) 221
MseI TTAA 1 cut(s) 153
MslI CAYNNNNRTG 2 cut(s) 102, 215
Msp20I TGGCCA 1 cut(s) 221
MspI CCGG 1 cut(s) 94
MspR9I CCNGG 2 cut(s) 19, 223
MvaI CCWGG 2 cut(s) 19, 223
MwoI GCNNNNNNNGC 2 cut(s) 43, 173
NdeII GATC 3 cut(s) 38, 61, 160
NlaIV GGNNCC 1 cut(s) 228
NmuCI GTSAC 1 cut(s) 124
PcsI WCGNNNNNNNCGW 2 cut(s) 30, 39
PfeI GAWTC 1 cut(s) 68
PleI GAGTC 1 cut(s) 67
PpsI GAGTC 1 cut(s) 67
PpuMI RGGWCCY 1 cut(s) 227
Psp5II RGGWCCY 1 cut(s) 227
Psp6I CCWGG 2 cut(s) 17, 221
PspGI CCWGG 2 cut(s) 17, 221
PspN4I GGNNCC 1 cut(s) 228
PspPI GGNCC 1 cut(s) 227
PspPPI RGGWCCY 1 cut(s) 227
RsaI GTAC 2 cut(s) 8, 92
RsaNI GTAC 2 cut(s) 7, 91
RseI CAYNNNNRTG 2 cut(s) 102, 215
SaqAI TTAA 1 cut(s) 153
Sau3AI GATC 3 cut(s) 38, 61, 160
Sau96I GGNCC 1 cut(s) 227
SchI GAGTC 1 cut(s) 67
ScrFI CCNGG 2 cut(s) 19, 223
SetI ASST 5 cut(s) 12, 17, 114, 215, 238
SfaNI GCATC 1 cut(s) 163
SinI GGWCC 1 cut(s) 227
SmiMI CAYNNNNRTG 2 cut(s) 102, 215
Sse9I AATT 2 cut(s) 26, 149
SsiI CCGC 1 cut(s) 55
StyD4I CCNGG 2 cut(s) 17, 221
TaiI ACGT 2 cut(s) 12, 17
TaqI TCGA 2 cut(s) 33, 71
TasI AATT 2 cut(s) 26, 149
TfiI GAWTC 1 cut(s) 68
Tru1I TTAA 1 cut(s) 153
Tru9I TTAA 1 cut(s) 153
TseFI GTSAC 1 cut(s) 124
Tsp45I GTSAC 1 cut(s) 124
TspDTI ATGAA 1 cut(s) 101
TspGWI ACGGA 1 cut(s) 31
VpaK11BI GGWCC 1 cut(s) 227
XapI RAATTY 2 cut(s) 26, 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.