Rh6AG313500

Signal-recognition-particle assembly has a crucial role in targeting secretory proteins to the rough endoplasmic reticulum membrane. SRP9 together with SRP14 and the Alu portion of the SRP RNA, constitutes the elongation arrest domain of SRP. The complex of SRP9 and SRP14 is required for SRP RNA binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0012969
Physical Location & Seq
Reverse (-)
51275115 .. 51277383
2269 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG313500.1

Sequence Viewer

Length: 228 bp
ATGAAGTACCGGCATTGCGATGGAAAGCTGGTTCTCAAAGTCACCGATAATAAAGAGTGTCTGAAATTTAAGACAGATCAGGCGCAGGATGCTAAGAAGATGGAGAAACTGAACAACATATTCTTCACCTTGATGGCCAGGGGTCCTGAAGTTGATCCATCGGAAGTTACTGGGAAAGATCAGATGGATGCACAGCCAACCAAAAAAGGCAGGGGAAGGAAACAATAG

Protein Analysis

75

Amino Acids

8.62

Weight (kDa)

9.52

Isoelectric Point (pI)

33.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012969)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G49100 AT3G49100
fragaria_vesca FvH4_2g22310
malus_domestica MD05G1204500.v1.1 MD10G1191500.v1.1
prunus_persica Prupe.8G230800_v2.0.a1
pyrus_communis pycom05g19080 pycom10g16510
rosa_chinensis RchiOBHm_Chr6g0289311
rosa_laevigata RLG00000012314
rosa_multiflora Rmu_sc0001527.1_g000023
rosa_roxburghii Rroxscaffold_7G00179350
rosa_rugosa Rorug06G0202600
rosa_samantha Rh6AG313500 Rh6BG321000 Rh6CG327200 Rh6DG312900
rosa_wichuraiana Rw6G027100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 149
AcoI YGGCCR 1 cut(s) 135
AcsI RAATTY 1 cut(s) 65
AcuI CTGAAG 1 cut(s) 168
AfaI GTAC 1 cut(s) 8
AjnI CCWGG 1 cut(s) 137
AloI GAACNNNNNNTCC 2 cut(s) 15, 47
AluBI AGCT 1 cut(s) 28
AluI AGCT 1 cut(s) 28
AlwI GGATC 1 cut(s) 149
AoxI GGCC 1 cut(s) 135
ApoI RAATTY 1 cut(s) 65
AspLEI GCGC 1 cut(s) 85
AspS9I GGNCC 1 cut(s) 143
AsuHPI GGTGA 2 cut(s) 34, 118
AvaII GGWCC 1 cut(s) 143
BalI TGGCCA 1 cut(s) 137
BccI CCATC 5 cut(s) 14, 94, 127, 166, 178
BciT130I CCWGG 1 cut(s) 139
Bme1390I CCNGG 1 cut(s) 139
Bme18I GGWCC 1 cut(s) 143
BmgT120I GGNCC 1 cut(s) 143
BmiI GGNNCC 1 cut(s) 144
BmrFI CCNGG 1 cut(s) 139
BmrI ACTGGG 1 cut(s) 180
BmsI GCATC 2 cut(s) 79, 178
BmuI ACTGGG 1 cut(s) 180
BsaJI CCNNGG 1 cut(s) 138
Bse118I RCCGGY 1 cut(s) 9
Bse1I ACTGG 1 cut(s) 175
Bse3DI GCAATG 1 cut(s) 13
BseBI CCWGG 1 cut(s) 139
BseDI CCNNGG 1 cut(s) 138
BseGI GGATG 2 cut(s) 94, 193
BseMI GCAATG 1 cut(s) 13
BseNI ACTGG 1 cut(s) 175
BshFI GGCC 1 cut(s) 137
BsiSI CCGG 1 cut(s) 10
BsnI GGCC 1 cut(s) 137
Bsp143I GATC 3 cut(s) 76, 154, 178
BspANI GGCC 1 cut(s) 137
BspLI GGNNCC 1 cut(s) 144
BspPI GGATC 1 cut(s) 149
BsrDI GCAATG 1 cut(s) 13
BsrFI RCCGGY 1 cut(s) 9
BsrI ACTGG 1 cut(s) 175
BssAI RCCGGY 1 cut(s) 9
BssECI CCNNGG 1 cut(s) 138
BssMI GATC 3 cut(s) 76, 154, 178
Bst2UI CCWGG 1 cut(s) 139
BstDEI CTNAG 1 cut(s) 93
BstF5I GGATG 2 cut(s) 94, 193
BstHHI GCGC 1 cut(s) 85
BstKTI GATC 3 cut(s) 79, 157, 181
BstMBI GATC 3 cut(s) 76, 154, 178
BstMWI GCNNNNNNNGC 1 cut(s) 89
BstNI CCWGG 1 cut(s) 139
BstSCI CCNGG 1 cut(s) 137
BsuRI GGCC 1 cut(s) 137
BtgZI GCGATG 1 cut(s) 33
BtsCI GGATG 2 cut(s) 94, 193
CfoI GCGC 1 cut(s) 85
Cfr10I RCCGGY 1 cut(s) 9
Cfr13I GGNCC 1 cut(s) 143
Csp6I GTAC 1 cut(s) 7
CviJI RGCY 3 cut(s) 28, 137, 196
CviKI_1 RGCY 3 cut(s) 28, 137, 196
CviQI GTAC 1 cut(s) 7
DdeI CTNAG 1 cut(s) 93
DpnI GATC 3 cut(s) 78, 156, 180
DpnII GATC 3 cut(s) 76, 154, 178
EaeI YGGCCR 1 cut(s) 135
Eco47I GGWCC 1 cut(s) 143
Eco57I CTGAAG 1 cut(s) 168
EcoO109I RGGNCCY 1 cut(s) 143
EcoRII CCWGG 1 cut(s) 137
FaiI YATR 1 cut(s) 119
FokI GGATG 2 cut(s) 101, 200
GlaI GCGC 1 cut(s) 84
HaeIII GGCC 1 cut(s) 137
HapII CCGG 1 cut(s) 10
HhaI GCGC 1 cut(s) 85
Hin6I GCGC 1 cut(s) 83
HinP1I GCGC 1 cut(s) 83
HpaII CCGG 1 cut(s) 10
HphI GGTGA 2 cut(s) 34, 118
Hpy188I TCNGA 3 cut(s) 63, 163, 183
Hpy188III TCNNGA 1 cut(s) 146
HpyAV CCTTC 1 cut(s) 210
HpyCH4V TGCA 1 cut(s) 191
HpyF10VI GCNNNNNNNGC 1 cut(s) 89
HpyF3I CTNAG 1 cut(s) 93
HspAI GCGC 1 cut(s) 83
Kzo9I GATC 3 cut(s) 76, 154, 178
LpnPI CCDG 9 cut(s) 14, 23, 65, 71, 124, 151, 156, 159, 196
LweI GCATC 2 cut(s) 79, 178
MaeIII GTNAC 2 cut(s) 40, 166
MalI GATC 3 cut(s) 78, 156, 180
MboI GATC 3 cut(s) 76, 154, 178
MboII GAAGA 2 cut(s) 109, 115
MlsI TGGCCA 1 cut(s) 137
MluCI AATT 1 cut(s) 65
MluNI TGGCCA 1 cut(s) 137
Mox20I TGGCCA 1 cut(s) 137
MscI TGGCCA 1 cut(s) 137
MseI TTAA 1 cut(s) 69
MslI CAYNNNNRTG 2 cut(s) 18, 131
Msp20I TGGCCA 1 cut(s) 137
MspI CCGG 1 cut(s) 10
MspR9I CCNGG 1 cut(s) 139
MvaI CCWGG 1 cut(s) 139
MwoI GCNNNNNNNGC 1 cut(s) 89
NdeII GATC 3 cut(s) 76, 154, 178
NlaIV GGNNCC 1 cut(s) 144
NmuCI GTSAC 1 cut(s) 40
PpuMI RGGWCCY 1 cut(s) 143
Psp5II RGGWCCY 1 cut(s) 143
Psp6I CCWGG 1 cut(s) 137
PspGI CCWGG 1 cut(s) 137
PspN4I GGNNCC 1 cut(s) 144
PspPI GGNCC 1 cut(s) 143
PspPPI RGGWCCY 1 cut(s) 143
RsaI GTAC 1 cut(s) 8
RsaNI GTAC 1 cut(s) 7
RseI CAYNNNNRTG 2 cut(s) 18, 131
SaqAI TTAA 1 cut(s) 69
Sau3AI GATC 3 cut(s) 76, 154, 178
Sau96I GGNCC 1 cut(s) 143
ScrFI CCNGG 1 cut(s) 139
SetI ASST 2 cut(s) 30, 131
SfaNI GCATC 2 cut(s) 79, 178
SinI GGWCC 1 cut(s) 143
SmiMI CAYNNNNRTG 2 cut(s) 18, 131
Sse9I AATT 1 cut(s) 65
StyD4I CCNGG 1 cut(s) 137
TasI AATT 1 cut(s) 65
Tru1I TTAA 1 cut(s) 69
Tru9I TTAA 1 cut(s) 69
TseFI GTSAC 1 cut(s) 40
Tsp45I GTSAC 1 cut(s) 40
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 143
XapI RAATTY 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.