Prupe.8G230800_v2.0.a1

Signal-recognition-particle assembly has a crucial role in targeting secretory proteins to the rough endoplasmic reticulum membrane. SRP9 together with SRP14 and the Alu portion of the SRP RNA, constitutes the elongation arrest domain of SRP. The complex of SRP9 and SRP14 is required for SRP RNA binding

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Reverse (-)
20580715 .. 20583450
2736 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G230800.1

Sequence Viewer

Length: 312 bp
ATGGTTTATATAACTTCCTGGGATGAATTCGTCGACCGATCCGTACAGCTTTTCCGTGCCGATCCCGAATCTACGCGATATGTGATGAAGTACAGGCATTGCGATGGGAAATTGGTTCTCAAAGTCACTGATAATAAAGAGTGTCTGAAATTTAAAACAGATCAGGCACAGGATGCAAAGAAGATGGAAAAACTTAACAATGTATTCTTCACTTTGATGTCCAGGGGTCCAGAAGCGGATCCTGCAGAAGTTACCGGGAAAGACCAGATGGATGCACAGCCAACCAAGAAAGGAAGGGGAAGGAAACAATAG

Protein Analysis

104

Amino Acids

11.97

Weight (kDa)

9.12

Isoelectric Point (pI)

29.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012969)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G49100 AT3G49100
fragaria_vesca FvH4_2g22310
malus_domestica MD05G1204500.v1.1 MD10G1191500.v1.1
prunus_persica Prupe.8G230800_v2.0.a1
pyrus_communis pycom05g19080 pycom10g16510
rosa_chinensis RchiOBHm_Chr6g0289311
rosa_laevigata RLG00000012314
rosa_multiflora Rmu_sc0001527.1_g000023
rosa_roxburghii Rroxscaffold_7G00179350
rosa_rugosa Rorug06G0202600
rosa_samantha Rh6AG313500 Rh6BG321000 Rh6CG327200 Rh6DG312900
rosa_wichuraiana Rw6G027100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 33
AccII CGCG 1 cut(s) 76
AciI CCGC 1 cut(s) 236
AclWI GGATC 4 cut(s) 33, 56, 233, 246
AcsI RAATTY 2 cut(s) 26, 149
AfaI GTAC 2 cut(s) 45, 92
AjnI CCWGG 2 cut(s) 17, 221
AluBI AGCT 1 cut(s) 49
AluI AGCT 1 cut(s) 49
AlwI GGATC 4 cut(s) 33, 56, 233, 246
ApoI RAATTY 2 cut(s) 26, 149
AspS9I GGNCC 1 cut(s) 227
AsuC2I CCSGG 1 cut(s) 256
AvaII GGWCC 1 cut(s) 227
BamHI GGATCC 1 cut(s) 238
BccI CCATC 3 cut(s) 98, 178, 262
BciT130I CCWGG 2 cut(s) 19, 223
BcnI CCSGG 1 cut(s) 256
BfmI CTRYAG 1 cut(s) 243
Bme1390I CCNGG 3 cut(s) 19, 223, 256
Bme18I GGWCC 1 cut(s) 227
BmgT120I GGNCC 1 cut(s) 227
BmiI GGNNCC 2 cut(s) 228, 240
BmrFI CCNGG 3 cut(s) 19, 223, 256
BmsI GCATC 2 cut(s) 163, 262
BpuMI CCSGG 1 cut(s) 256
BsaJI CCNNGG 2 cut(s) 18, 222
Bse3DI GCAATG 1 cut(s) 97
BseBI CCWGG 2 cut(s) 19, 223
BseDI CCNNGG 2 cut(s) 18, 222
BseGI GGATG 3 cut(s) 28, 178, 277
BseMI GCAATG 1 cut(s) 97
Bsh1236I CGCG 1 cut(s) 76
Bsh1285I CGRYCG 1 cut(s) 37
BsiEI CGRYCG 1 cut(s) 37
BsiSI CCGG 1 cut(s) 255
Bsp143I GATC 4 cut(s) 38, 61, 160, 238
BspACI CCGC 1 cut(s) 236
BspFNI CGCG 1 cut(s) 76
BspLI GGNNCC 2 cut(s) 228, 240
BspMAI CTGCAG 1 cut(s) 247
BspPI GGATC 4 cut(s) 33, 56, 233, 246
BsrDI GCAATG 1 cut(s) 97
BssECI CCNNGG 2 cut(s) 18, 222
BssMI GATC 4 cut(s) 38, 61, 160, 238
Bst2UI CCWGG 2 cut(s) 19, 223
BstAPI GCANNNNNTGC 1 cut(s) 173
BstF5I GGATG 3 cut(s) 28, 178, 277
BstFNI CGCG 1 cut(s) 76
BstKTI GATC 4 cut(s) 41, 64, 163, 241
BstMBI GATC 4 cut(s) 38, 61, 160, 238
BstMCI CGRYCG 1 cut(s) 37
BstMWI GCNNNNNNNGC 2 cut(s) 173, 242
BstNI CCWGG 2 cut(s) 19, 223
BstSCI CCNGG 3 cut(s) 17, 221, 254
BstSFI CTRYAG 1 cut(s) 243
BstUI CGCG 1 cut(s) 76
BstX2I RGATCY 1 cut(s) 238
BstYI RGATCY 1 cut(s) 238
BtgZI GCGATG 1 cut(s) 117
BtsCI GGATG 3 cut(s) 28, 178, 277
BtsIMutI CAGTG 1 cut(s) 126
Cfr13I GGNCC 1 cut(s) 227
Csp6I GTAC 2 cut(s) 44, 91
CviJI RGCY 2 cut(s) 49, 280
CviKI_1 RGCY 2 cut(s) 49, 280
CviQI GTAC 2 cut(s) 44, 91
DpnI GATC 4 cut(s) 40, 63, 162, 240
DpnII GATC 4 cut(s) 38, 61, 160, 238
DraI TTTAAA 1 cut(s) 154
Eco47I GGWCC 1 cut(s) 227
EcoRI GAATTC 1 cut(s) 26
EcoRII CCWGG 2 cut(s) 17, 221
FaiI YATR 3 cut(s) 9, 11, 81
FblI GTMKAC 1 cut(s) 33
FokI GGATG 3 cut(s) 35, 185, 284
HapII CCGG 1 cut(s) 255
HincII GTYRAC 1 cut(s) 34
HindII GTYRAC 1 cut(s) 34
HinfI GANTC 1 cut(s) 68
HpaII CCGG 1 cut(s) 255
Hpy166II GTNNAC 1 cut(s) 34
Hpy188I TCNGA 1 cut(s) 147
Hpy188III TCNNGA 2 cut(s) 65, 230
Hpy8I GTNNAC 1 cut(s) 34
Hpy99I CGWCG 1 cut(s) 35
HpyAV CCTTC 2 cut(s) 288, 294
HpyCH4V TGCA 3 cut(s) 176, 245, 275
HpyF10VI GCNNNNNNNGC 2 cut(s) 173, 242
Kzo9I GATC 4 cut(s) 38, 61, 160, 238
LweI GCATC 2 cut(s) 163, 262
MaeIII GTNAC 2 cut(s) 124, 250
MalI GATC 4 cut(s) 40, 63, 162, 240
MboI GATC 4 cut(s) 38, 61, 160, 238
MboII GAAGA 2 cut(s) 193, 199
MflI RGATCY 1 cut(s) 238
MluCI AATT 3 cut(s) 26, 110, 149
MseI TTAA 2 cut(s) 153, 195
MslI CAYNNNNRTG 2 cut(s) 102, 215
MspI CCGG 1 cut(s) 255
MspR9I CCNGG 3 cut(s) 19, 223, 256
MvaI CCWGG 2 cut(s) 19, 223
MvnI CGCG 1 cut(s) 76
MwoI GCNNNNNNNGC 2 cut(s) 173, 242
NciI CCSGG 1 cut(s) 256
NdeII GATC 4 cut(s) 38, 61, 160, 238
NlaIV GGNNCC 2 cut(s) 228, 240
NmuCI GTSAC 1 cut(s) 124
PcsI WCGNNNNNNNCGW 1 cut(s) 39
PfeI GAWTC 1 cut(s) 68
Psp6I CCWGG 2 cut(s) 17, 221
PspGI CCWGG 2 cut(s) 17, 221
PspN4I GGNNCC 2 cut(s) 228, 240
PspPI GGNCC 1 cut(s) 227
PstI CTGCAG 1 cut(s) 247
PsuI RGATCY 1 cut(s) 238
RsaI GTAC 2 cut(s) 45, 92
RsaNI GTAC 2 cut(s) 44, 91
RseI CAYNNNNRTG 2 cut(s) 102, 215
SalI GTCGAC 1 cut(s) 32
SaqAI TTAA 2 cut(s) 153, 195
Sau3AI GATC 4 cut(s) 38, 61, 160, 238
Sau96I GGNCC 1 cut(s) 227
ScrFI CCNGG 3 cut(s) 19, 223, 256
SetI ASST 1 cut(s) 51
SfaNI GCATC 2 cut(s) 163, 262
SfcI CTRYAG 1 cut(s) 243
SinI GGWCC 1 cut(s) 227
SmiMI CAYNNNNRTG 2 cut(s) 102, 215
Sse9I AATT 3 cut(s) 26, 110, 149
SsiI CCGC 1 cut(s) 236
StyD4I CCNGG 3 cut(s) 17, 221, 254
TaqI TCGA 1 cut(s) 33
TaqII GACCGA 1 cut(s) 51
TasI AATT 3 cut(s) 26, 110, 149
TatI WGTACW 1 cut(s) 90
TfiI GAWTC 1 cut(s) 68
Tru1I TTAA 2 cut(s) 153, 195
Tru9I TTAA 2 cut(s) 153, 195
TscAI CASTG 1 cut(s) 133
TseFI GTSAC 1 cut(s) 124
Tsp45I GTSAC 1 cut(s) 124
TspDTI ATGAA 2 cut(s) 39, 101
TspGWI ACGGA 2 cut(s) 31, 44
TspRI CASTG 1 cut(s) 133
VpaK11BI GGWCC 1 cut(s) 227
XapI RAATTY 2 cut(s) 26, 149
XmiI GTMKAC 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.