Rroxscaffold_7G00179350

Signal-recognition-particle assembly has a crucial role in targeting secretory proteins to the rough endoplasmic reticulum membrane. SRP9 together with SRP14 and the Alu portion of the SRP RNA, constitutes the elongation arrest domain of SRP. The complex of SRP9 and SRP14 is required for SRP RNA binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0012969
Physical Location & Seq
Forward (+)
18956445 .. 18958571
2127 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00179350.1

Sequence Viewer

Length: 384 bp
ATGGTGTACGTTACGTCCTGGGACGAATTCGTCGAGCGATCCGTGCAGTTGTTCCGCAACGATCCTGATTCGACTCGATATGTGATGAAGTACCGGCATTGCGATGGAAAGCTGGTTCTCAAAGTCACCGATAATAAAGAGAGTTTGAAGCTGCCTTTGATATTAGGATTTGAGTCAGAATCGCTTACAAGGGTTCCCATTGAGGAATTGATGTGTCTGAAATTTAAGACAGATCAGGCGCAGGATGCTAAGAAGATGGAGAAACTGAACAACATATTCTTCACCTTGATGGCCAGGGGTCCTGAAGTTGATCCATCGGAAGTTACTGGGAAAGATCAGATGGATGCACAGCCAACCAAAAAAGGCAGGGGAAGGAAACAATAG

Protein Analysis

127

Amino Acids

14.73

Weight (kDa)

8.51

Isoelectric Point (pI)

39.04

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SRP9-21 PF05486 4 - 90 2.5e-11 Signal recognition particle 9 kDa protein (SRP9)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012969)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G49100 AT3G49100
fragaria_vesca FvH4_2g22310
malus_domestica MD05G1204500.v1.1 MD10G1191500.v1.1
prunus_persica Prupe.8G230800_v2.0.a1
pyrus_communis pycom05g19080 pycom10g16510
rosa_chinensis RchiOBHm_Chr6g0289311
rosa_laevigata RLG00000012314
rosa_multiflora Rmu_sc0001527.1_g000023
rosa_roxburghii Rroxscaffold_7G00179350
rosa_rugosa Rorug06G0202600
rosa_samantha Rh6AG313500 Rh6BG321000 Rh6CG327200 Rh6DG312900
rosa_wichuraiana Rw6G027100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 29
AciI CCGC 1 cut(s) 55
AclWI GGATC 3 cut(s) 33, 56, 305
AcoI YGGCCR 1 cut(s) 291
AcsI RAATTY 2 cut(s) 26, 221
AcuI CTGAAG 1 cut(s) 324
AfaI GTAC 2 cut(s) 8, 92
AgsI TTSAA 1 cut(s) 148
AjnI CCWGG 2 cut(s) 17, 293
AloI GAACNNNNNNTCC 2 cut(s) 99, 131
AluBI AGCT 2 cut(s) 112, 151
AluI AGCT 2 cut(s) 112, 151
AlwI GGATC 3 cut(s) 33, 56, 305
AoxI GGCC 1 cut(s) 291
ApeKI GCWGC 1 cut(s) 151
ApoI RAATTY 2 cut(s) 26, 221
AspLEI GCGC 1 cut(s) 241
AspS9I GGNCC 1 cut(s) 299
AsuHPI GGTGA 2 cut(s) 118, 274
AvaII GGWCC 1 cut(s) 299
BalI TGGCCA 1 cut(s) 293
BbvI GCAGC 1 cut(s) 138
BccI CCATC 5 cut(s) 98, 250, 283, 322, 334
BciT130I CCWGG 2 cut(s) 19, 295
BisI GCNGC 1 cut(s) 152
BlsI GCNGC 1 cut(s) 153
Bme1390I CCNGG 2 cut(s) 19, 295
Bme18I GGWCC 1 cut(s) 299
BmgT120I GGNCC 1 cut(s) 299
BmiI GGNNCC 2 cut(s) 195, 300
BmrFI CCNGG 2 cut(s) 19, 295
BmrI ACTGGG 1 cut(s) 336
BmsI GCATC 2 cut(s) 235, 334
BmuI ACTGGG 1 cut(s) 336
BsaJI CCNNGG 2 cut(s) 18, 294
Bse118I RCCGGY 1 cut(s) 93
Bse1I ACTGG 1 cut(s) 331
Bse3DI GCAATG 1 cut(s) 97
BseBI CCWGG 2 cut(s) 19, 295
BseDI CCNNGG 2 cut(s) 18, 294
BseGI GGATG 2 cut(s) 250, 349
BseMI GCAATG 1 cut(s) 97
BseNI ACTGG 1 cut(s) 331
BseXI GCAGC 1 cut(s) 138
BsgI GTGCAG 1 cut(s) 65
BshFI GGCC 1 cut(s) 293
BsiSI CCGG 1 cut(s) 94
BslFI GGGAC 1 cut(s) 35
BsmFI GGGAC 1 cut(s) 35
BsnI GGCC 1 cut(s) 293
Bsp143I GATC 5 cut(s) 38, 61, 232, 310, 334
BspACI CCGC 1 cut(s) 55
BspANI GGCC 1 cut(s) 293
BspLI GGNNCC 2 cut(s) 195, 300
BspPI GGATC 3 cut(s) 33, 56, 305
BsrDI GCAATG 1 cut(s) 97
BsrFI RCCGGY 1 cut(s) 93
BsrI ACTGG 1 cut(s) 331
BssAI RCCGGY 1 cut(s) 93
BssECI CCNNGG 2 cut(s) 18, 294
BssMI GATC 5 cut(s) 38, 61, 232, 310, 334
Bst2UI CCWGG 2 cut(s) 19, 295
BstDEI CTNAG 1 cut(s) 249
BstF5I GGATG 2 cut(s) 250, 349
BstHHI GCGC 1 cut(s) 241
BstKTI GATC 5 cut(s) 41, 64, 235, 313, 337
BstMBI GATC 5 cut(s) 38, 61, 232, 310, 334
BstMWI GCNNNNNNNGC 2 cut(s) 43, 245
BstNI CCWGG 2 cut(s) 19, 295
BstSCI CCNGG 2 cut(s) 17, 293
BstV1I GCAGC 1 cut(s) 138
BsuRI GGCC 1 cut(s) 293
BtgZI GCGATG 1 cut(s) 117
BtsCI GGATG 2 cut(s) 250, 349
CfoI GCGC 1 cut(s) 241
Cfr10I RCCGGY 1 cut(s) 93
Cfr13I GGNCC 1 cut(s) 299
Csp6I GTAC 2 cut(s) 7, 91
CviJI RGCY 4 cut(s) 112, 151, 293, 352
CviKI_1 RGCY 4 cut(s) 112, 151, 293, 352
CviQI GTAC 2 cut(s) 7, 91
DdeI CTNAG 1 cut(s) 249
DpnI GATC 5 cut(s) 40, 63, 234, 312, 336
DpnII GATC 5 cut(s) 38, 61, 232, 310, 334
DrdI GACNNNNNNGTC 1 cut(s) 29
DseDI GACNNNNNNGTC 1 cut(s) 29
EaeI YGGCCR 1 cut(s) 291
Eco47I GGWCC 1 cut(s) 299
Eco57I CTGAAG 1 cut(s) 324
EcoO109I RGGNCCY 1 cut(s) 299
EcoRI GAATTC 1 cut(s) 26
EcoRII CCWGG 2 cut(s) 17, 293
FaiI YATR 2 cut(s) 81, 275
FaqI GGGAC 1 cut(s) 35
Fnu4HI GCNGC 1 cut(s) 152
FokI GGATG 2 cut(s) 257, 356
Fsp4HI GCNGC 1 cut(s) 152
GlaI GCGC 1 cut(s) 240
GluI GCNGC 1 cut(s) 152
HaeIII GGCC 1 cut(s) 293
HapII CCGG 1 cut(s) 94
HhaI GCGC 1 cut(s) 241
Hin6I GCGC 1 cut(s) 239
HinP1I GCGC 1 cut(s) 239
HinfI GANTC 4 cut(s) 68, 73, 173, 179
HpaII CCGG 1 cut(s) 94
HphI GGTGA 2 cut(s) 118, 274
Hpy166II GTNNAC 1 cut(s) 7
Hpy188I TCNGA 4 cut(s) 178, 219, 319, 339
Hpy188III TCNNGA 2 cut(s) 65, 302
Hpy8I GTNNAC 1 cut(s) 7
Hpy99I CGWCG 1 cut(s) 35
HpyAV CCTTC 1 cut(s) 366
HpyCH4IV ACGT 2 cut(s) 9, 14
HpyCH4V TGCA 2 cut(s) 46, 347
HpyF10VI GCNNNNNNNGC 2 cut(s) 43, 245
HpyF3I CTNAG 1 cut(s) 249
HpySE526I ACGT 2 cut(s) 9, 14
HspAI GCGC 1 cut(s) 239
Kzo9I GATC 5 cut(s) 38, 61, 232, 310, 334
Lsp1109I GCAGC 1 cut(s) 138
LweI GCATC 2 cut(s) 235, 334
MaeII ACGT 2 cut(s) 9, 14
MaeIII GTNAC 3 cut(s) 10, 124, 322
MalI GATC 5 cut(s) 40, 63, 234, 312, 336
MboI GATC 5 cut(s) 38, 61, 232, 310, 334
MboII GAAGA 2 cut(s) 265, 271
MlsI TGGCCA 1 cut(s) 293
MluCI AATT 3 cut(s) 26, 206, 221
MluNI TGGCCA 1 cut(s) 293
MlyI GAGTC 2 cut(s) 67, 182
MnlI CCTC 1 cut(s) 196
Mox20I TGGCCA 1 cut(s) 293
MscI TGGCCA 1 cut(s) 293
MseI TTAA 1 cut(s) 225
MslI CAYNNNNRTG 2 cut(s) 102, 287
Msp20I TGGCCA 1 cut(s) 293
MspI CCGG 1 cut(s) 94
MspR9I CCNGG 2 cut(s) 19, 295
MvaI CCWGG 2 cut(s) 19, 295
MwoI GCNNNNNNNGC 2 cut(s) 43, 245
NdeII GATC 5 cut(s) 38, 61, 232, 310, 334
NlaIV GGNNCC 2 cut(s) 195, 300
NmuCI GTSAC 1 cut(s) 124
PcsI WCGNNNNNNNCGW 2 cut(s) 30, 39
PfeI GAWTC 2 cut(s) 68, 179
PkrI GCNGC 1 cut(s) 153
PleI GAGTC 2 cut(s) 67, 181
PpsI GAGTC 2 cut(s) 67, 181
PpuMI RGGWCCY 1 cut(s) 299
Psp5II RGGWCCY 1 cut(s) 299
Psp6I CCWGG 2 cut(s) 17, 293
PspGI CCWGG 2 cut(s) 17, 293
PspN4I GGNNCC 2 cut(s) 195, 300
PspPI GGNCC 1 cut(s) 299
PspPPI RGGWCCY 1 cut(s) 299
RsaI GTAC 2 cut(s) 8, 92
RsaNI GTAC 2 cut(s) 7, 91
RseI CAYNNNNRTG 2 cut(s) 102, 287
SaqAI TTAA 1 cut(s) 225
SatI GCNGC 1 cut(s) 152
Sau3AI GATC 5 cut(s) 38, 61, 232, 310, 334
Sau96I GGNCC 1 cut(s) 299
SchI GAGTC 2 cut(s) 67, 182
ScrFI CCNGG 2 cut(s) 19, 295
SetI ASST 5 cut(s) 12, 17, 114, 153, 287
SfaNI GCATC 2 cut(s) 235, 334
SinI GGWCC 1 cut(s) 299
SmiMI CAYNNNNRTG 2 cut(s) 102, 287
Sse9I AATT 3 cut(s) 26, 206, 221
SsiI CCGC 1 cut(s) 55
StyD4I CCNGG 2 cut(s) 17, 293
TaiI ACGT 2 cut(s) 12, 17
TaqI TCGA 3 cut(s) 33, 71, 76
TasI AATT 3 cut(s) 26, 206, 221
TfiI GAWTC 2 cut(s) 68, 179
Tru1I TTAA 1 cut(s) 225
Tru9I TTAA 1 cut(s) 225
TseFI GTSAC 1 cut(s) 124
TseI GCWGC 1 cut(s) 151
Tsp45I GTSAC 1 cut(s) 124
TspDTI ATGAA 1 cut(s) 101
TspGWI ACGGA 1 cut(s) 31
VpaK11BI GGWCC 1 cut(s) 299
XapI RAATTY 2 cut(s) 26, 221
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.