MD06G1104600.v1.1

KAT8 regulatory NSL complex subunit

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
OG0007737
Physical Location & Seq
Reverse (-)
24319775 .. 24320243
469 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1104600.v1.1.491

Sequence Viewer

Length: 228 bp
ATGATCAGGTGGAAGAAGATGTTGGAAAAAGCACTAAATGCTCTAGAAGTTGTTATCTTCGATTACCCGTATATTTCTGGTGGGAAAAAGAGGGCTCCTTCAAAGGCTGAAAAGTTGGTCGATTTTCGTGGCGATGTTGCCAAAAAGGCGGTTGCTAAGTACCCGGGTCATCCGTTGATTTTGGCCGGGAAACCTATGGGTTCAAGGTTATACTTCTTTTTGTGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Abhydrolase_1 Abhydrolase_5 Abhydrolase_6 DLH

Protein Analysis

76

Amino Acids

8.47

Weight (kDa)

9.95

Isoelectric Point (pI)

33.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Abhydrolase_11 PF20408 12 - 70 1e-08 Alpha/beta hydrolase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 149
AcoI YGGCCR 1 cut(s) 183
AfaI GTAC 1 cut(s) 161
AgsI TTSAA 2 cut(s) 102, 204
AjuI GAANNNNNNNTTGG 1 cut(s) 37
Ama87I CYCGRG 1 cut(s) 163
AoxI GGCC 1 cut(s) 183
AsuC2I CCSGG 3 cut(s) 164, 165, 187
AvaI CYCGRG 1 cut(s) 163
BanII GRGCYC 1 cut(s) 97
BclI TGATCA 1 cut(s) 3
BcnI CCSGG 3 cut(s) 164, 165, 187
BfaI CTAG 1 cut(s) 44
BglI GCCNNNNNGGC 1 cut(s) 146
Bme1390I CCNGG 3 cut(s) 164, 165, 187
BmeT110I CYCGRG 1 cut(s) 163
BmiI GGNNCC 1 cut(s) 96
BmrFI CCNGG 3 cut(s) 164, 165, 187
BpuMI CCSGG 3 cut(s) 164, 165, 187
BsaJI CCNNGG 1 cut(s) 163
BseDI CCNNGG 1 cut(s) 163
BseGI GGATG 1 cut(s) 169
BshFI GGCC 1 cut(s) 185
BsiHKCI CYCGRG 1 cut(s) 163
BsiSI CCGG 2 cut(s) 164, 186
BsnI GGCC 1 cut(s) 185
BsoBI CYCGRG 1 cut(s) 163
Bsp1286I GDGCHC 1 cut(s) 97
Bsp143I GATC 1 cut(s) 3
BspACI CCGC 1 cut(s) 149
BspANI GGCC 1 cut(s) 185
BspLI GGNNCC 1 cut(s) 96
BssECI CCNNGG 1 cut(s) 163
BssMI GATC 1 cut(s) 3
BstAPI GCANNNNNTGC 1 cut(s) 38
BstDEI CTNAG 1 cut(s) 156
BstF5I GGATG 1 cut(s) 169
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstMWI GCNNNNNNNGC 2 cut(s) 38, 146
BstSCI CCNGG 3 cut(s) 162, 163, 185
BsuRI GGCC 1 cut(s) 185
BtgZI GCGATG 1 cut(s) 147
BtsCI GGATG 1 cut(s) 169
Cfr9I CCCGGG 1 cut(s) 163
Csp6I GTAC 1 cut(s) 160
CviJI RGCY 3 cut(s) 95, 107, 185
CviKI_1 RGCY 3 cut(s) 95, 107, 185
CviQI GTAC 1 cut(s) 160
DdeI CTNAG 1 cut(s) 156
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
EaeI YGGCCR 1 cut(s) 183
Eco24I GRGCYC 1 cut(s) 97
Eco88I CYCGRG 1 cut(s) 163
EcoT38I GRGCYC 1 cut(s) 97
FaiI YATR 3 cut(s) 72, 197, 211
FbaI TGATCA 1 cut(s) 3
FokI GGATG 1 cut(s) 156
FriOI GRGCYC 1 cut(s) 97
FspBI CTAG 1 cut(s) 44
HaeIII GGCC 1 cut(s) 185
HapII CCGG 2 cut(s) 164, 186
HpaII CCGG 2 cut(s) 164, 186
Hpy188III TCNNGA 1 cut(s) 44
HpyAV CCTTC 1 cut(s) 108
HpyF10VI GCNNNNNNNGC 2 cut(s) 38, 146
HpyF3I CTNAG 1 cut(s) 156
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 1 cut(s) 3
LmnI GCTCC 1 cut(s) 100
LpnPI CCDG 3 cut(s) 63, 177, 199
MaeI CTAG 1 cut(s) 44
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 3 cut(s) 25, 28, 49
MhlI GDGCHC 1 cut(s) 97
MnlI CCTC 1 cut(s) 84
MspI CCGG 2 cut(s) 164, 186
MspR9I CCNGG 3 cut(s) 164, 165, 187
MwoI GCNNNNNNNGC 2 cut(s) 38, 146
NciI CCSGG 3 cut(s) 164, 165, 187
NdeII GATC 1 cut(s) 3
NlaIV GGNNCC 1 cut(s) 96
PspN4I GGNNCC 1 cut(s) 96
RsaI GTAC 1 cut(s) 161
RsaNI GTAC 1 cut(s) 160
Sau3AI GATC 1 cut(s) 3
ScrFI CCNGG 3 cut(s) 164, 165, 187
SduI GDGCHC 1 cut(s) 97
SetI ASST 3 cut(s) 11, 196, 209
SmaI CCCGGG 1 cut(s) 165
SsiI CCGC 1 cut(s) 149
SspMI CTAG 1 cut(s) 44
StyD4I CCNGG 3 cut(s) 162, 163, 185
TaqI TCGA 2 cut(s) 60, 120
TspGWI ACGGA 1 cut(s) 162
TspMI CCCGGG 1 cut(s) 163
XbaI TCTAGA 1 cut(s) 43
XmaI CCCGGG 1 cut(s) 163
XspI CTAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.