MD06G1140400.v1.1

Protein of unknown function (DUF3339)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
OG0016502
Physical Location & Seq
Reverse (-)
28434711 .. 28435692
982 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1140400.v1.1.491

Sequence Viewer

Length: 300 bp
ATGTGTTGTATAAAACTCATGTTCCTGTTGGATCAGAGTGTTCAATTTCTTGCCATCAATTGTTACAACAAACACAGAAGAAAAATGGTGGATTGGGCACCAATTTTGATTGGGTTGTTAATGTTCATACTGCTCTCCCCTGGCCTCTTGTTTCAGATACCAGGAAATGTCAAGCATGTTGAGTTTGGAAGCTTCACCACAAATGGCAGAGCAATTATTGTCCACACTCTTATTTTCTTTGGCATCTTCACCATCCTCATTTTGGCAGTAAACATTATATATTTTACAAATTTGGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF3339

Protein Analysis

100

Amino Acids

11.32

Weight (kDa)

9.3

Isoelectric Point (pI)

30.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF3339 PF11820 29 - 92 1.7e-27 Protein of unknown function (DUF3339)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016502)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G01950 AT5G14110
malus_domestica MD06G1140400.v1.1 MD09G1009400.v1.1 MD14G1155600.v1.1
prunus_persica Prupe.5G149600_v2.0.a1
pyrus_communis pycom111g00760
rosa_chinensis RchiOBHm_Chr2g0175811 RchiOBHm_Chr7g0189911
rosa_roxburghii Rroxscaffold_3G00265060
rosa_rugosa Rorug02G0587900 Rorug06G0500800
rosa_samantha Rh2CG641400
rosa_wichuraiana Rw7G009200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 97
AclWI GGATC 1 cut(s) 39
AcsI RAATTY 1 cut(s) 289
AfiI CCNNNNNNNGG 1 cut(s) 262
AgsI TTSAA 1 cut(s) 44
AjnI CCWGG 2 cut(s) 139, 160
AluBI AGCT 1 cut(s) 192
AluI AGCT 1 cut(s) 192
AlwI GGATC 1 cut(s) 39
AoxI GGCC 1 cut(s) 142
ApoI RAATTY 1 cut(s) 289
AsuHPI GGTGA 2 cut(s) 187, 241
BaeGI GKGCMC 1 cut(s) 100
BanI GGYRCC 1 cut(s) 97
BccI CCATC 2 cut(s) 62, 260
BciT130I CCWGG 2 cut(s) 141, 162
Bme1390I CCNGG 2 cut(s) 141, 162
BmiI GGNNCC 1 cut(s) 99
BmrFI CCNGG 2 cut(s) 141, 162
BmsI GCATC 1 cut(s) 252
BsaJI CCNNGG 1 cut(s) 139
Bsc4I CCNNNNNNNGG 1 cut(s) 262
BseBI CCWGG 2 cut(s) 141, 162
BseDI CCNNGG 1 cut(s) 139
BseGI GGATG 1 cut(s) 252
BseLI CCNNNNNNNGG 1 cut(s) 262
BseSI GKGCMC 1 cut(s) 100
BshFI GGCC 1 cut(s) 144
BshNI GGYRCC 1 cut(s) 97
BslI CCNNNNNNNGG 1 cut(s) 262
BsnI GGCC 1 cut(s) 144
Bsp1286I GDGCHC 1 cut(s) 100
Bsp143I GATC 1 cut(s) 31
BspANI GGCC 1 cut(s) 144
BspLI GGNNCC 1 cut(s) 99
BspPI GGATC 1 cut(s) 39
BspT107I GGYRCC 1 cut(s) 97
BssECI CCNNGG 1 cut(s) 139
BssMI GATC 1 cut(s) 31
Bst2UI CCWGG 2 cut(s) 141, 162
BstF5I GGATG 1 cut(s) 252
BstKTI GATC 1 cut(s) 34
BstMBI GATC 1 cut(s) 31
BstNI CCWGG 2 cut(s) 141, 162
BstNSI RCATGY 1 cut(s) 179
BstSCI CCNGG 2 cut(s) 139, 160
BstSLI GKGCMC 1 cut(s) 100
BsuRI GGCC 1 cut(s) 144
BtsCI GGATG 1 cut(s) 252
CviAII CATG 2 cut(s) 19, 176
CviJI RGCY 2 cut(s) 144, 192
CviKI_1 RGCY 2 cut(s) 144, 192
DpnI GATC 1 cut(s) 33
DpnII GATC 1 cut(s) 31
EcoRII CCWGG 2 cut(s) 139, 160
FaeI CATG 2 cut(s) 22, 179
FaiI YATR 6 cut(s) 11, 20, 128, 177, 278, 280
FatI CATG 2 cut(s) 18, 175
FokI GGATG 1 cut(s) 239
HaeIII GGCC 1 cut(s) 144
Hin1II CATG 2 cut(s) 22, 179
HindIII AAGCTT 1 cut(s) 190
HphI GGTGA 2 cut(s) 187, 241
Hpy166II GTNNAC 2 cut(s) 223, 271
Hpy188I TCNGA 2 cut(s) 36, 156
Hpy8I GTNNAC 2 cut(s) 223, 271
Hsp92II CATG 2 cut(s) 22, 179
Kzo9I GATC 1 cut(s) 31
LpnPI CCDG 5 cut(s) 38, 126, 147, 153, 174
LweI GCATC 1 cut(s) 252
MaeIII GTNAC 1 cut(s) 62
MalI GATC 1 cut(s) 33
MboI GATC 1 cut(s) 31
MboII GAAGA 2 cut(s) 90, 238
MfeI CAATTG 1 cut(s) 58
MhlI GDGCHC 1 cut(s) 100
MluCI AATT 5 cut(s) 44, 58, 102, 213, 289
MmeI TCCRAC 1 cut(s) 9
MnlI CCTC 2 cut(s) 155, 266
MseI TTAA 2 cut(s) 119, 298
MspR9I CCNGG 2 cut(s) 141, 162
MunI CAATTG 1 cut(s) 58
MvaI CCWGG 2 cut(s) 141, 162
NdeII GATC 1 cut(s) 31
NlaIII CATG 2 cut(s) 22, 179
NlaIV GGNNCC 1 cut(s) 99
NspI RCATGY 1 cut(s) 179
Psp6I CCWGG 2 cut(s) 139, 160
PspGI CCWGG 2 cut(s) 139, 160
PspN4I GGNNCC 1 cut(s) 99
SaqAI TTAA 2 cut(s) 119, 298
Sau3AI GATC 1 cut(s) 31
ScrFI CCNGG 2 cut(s) 141, 162
SduI GDGCHC 1 cut(s) 100
SetI ASST 1 cut(s) 194
SfaNI GCATC 1 cut(s) 252
Sse9I AATT 5 cut(s) 44, 58, 102, 213, 289
StyD4I CCNGG 2 cut(s) 139, 160
TasI AATT 5 cut(s) 44, 58, 102, 213, 289
Tru1I TTAA 2 cut(s) 119, 298
Tru9I TTAA 2 cut(s) 119, 298
TspDTI ATGAA 1 cut(s) 115
XapI RAATTY 1 cut(s) 289
XceI RCATGY 1 cut(s) 179
XcmI CCANNNNNNNNNTGG 1 cut(s) 259
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.