RchiOBHm_Chr7g0189911

Protein of unknown function (DUF3339)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
9222194 .. 9222532
339 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ16961

Sequence Viewer

Length: 210 bp
ATGTTGGACTGGGCACCCATTTTTCTAGGGTTCTTGTTGTTCGTATTGCTCTCTCCTGGACTCCTGTTCCAGCTACCTGGAAACTCCAAGAATGTTGAGTTTGGGAGCTTCACCACAAATGGCAAGGCCATTATTGTCCACACACTCCTCTTCTTTGTCATCTTTACCATCCTTATCTTGGCAGTAGGCATCCAAATCCACACAGGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

7.58

Weight (kDa)

6.69

Isoelectric Point (pI)

13.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF3339 PF11820 1 - 67 1.9e-29 Protein of unknown function (DUF3339)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016502)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 13
AfiI CCNNNNNNNGG 1 cut(s) 178
AjnI CCWGG 2 cut(s) 55, 76
AluBI AGCT 2 cut(s) 73, 108
AluI AGCT 2 cut(s) 73, 108
AoxI GGCC 1 cut(s) 126
AsuHPI GGTGA 1 cut(s) 103
BaeGI GKGCMC 1 cut(s) 16
BanI GGYRCC 1 cut(s) 13
BccI CCATC 1 cut(s) 176
BciT130I CCWGG 2 cut(s) 57, 78
BfaI CTAG 1 cut(s) 26
Bme1390I CCNGG 2 cut(s) 57, 78
BmiI GGNNCC 1 cut(s) 15
BmrFI CCNGG 2 cut(s) 57, 78
BmrI ACTGGG 1 cut(s) 19
BmsI GCATC 1 cut(s) 198
BmuI ACTGGG 1 cut(s) 19
Bsc4I CCNNNNNNNGG 1 cut(s) 178
Bse1I ACTGG 1 cut(s) 14
BseBI CCWGG 2 cut(s) 57, 78
BseGI GGATG 2 cut(s) 168, 189
BseLI CCNNNNNNNGG 1 cut(s) 178
BseNI ACTGG 1 cut(s) 14
BseRI GAGGAG 1 cut(s) 137
BseSI GKGCMC 1 cut(s) 16
BshFI GGCC 1 cut(s) 128
BshNI GGYRCC 1 cut(s) 13
BslI CCNNNNNNNGG 1 cut(s) 178
BsnI GGCC 1 cut(s) 128
Bsp1286I GDGCHC 1 cut(s) 16
BspANI GGCC 1 cut(s) 128
BspLI GGNNCC 1 cut(s) 15
BspT107I GGYRCC 1 cut(s) 13
BsrI ACTGG 1 cut(s) 14
Bst2UI CCWGG 2 cut(s) 57, 78
Bst6I CTCTTC 1 cut(s) 155
BstF5I GGATG 2 cut(s) 168, 189
BstNI CCWGG 2 cut(s) 57, 78
BstSCI CCNGG 2 cut(s) 55, 76
BstSLI GKGCMC 1 cut(s) 16
BstXI CCANNNNNNTGG 1 cut(s) 77
BsuRI GGCC 1 cut(s) 128
BtsCI GGATG 2 cut(s) 168, 189
CviJI RGCY 4 cut(s) 73, 108, 128, 207
CviKI_1 RGCY 4 cut(s) 73, 108, 128, 207
Eam1104I CTCTTC 1 cut(s) 155
EarI CTCTTC 1 cut(s) 155
EcoRII CCWGG 2 cut(s) 55, 76
FokI GGATG 2 cut(s) 155, 176
FspBI CTAG 1 cut(s) 26
HaeIII GGCC 1 cut(s) 128
HinfI GANTC 1 cut(s) 60
HphI GGTGA 1 cut(s) 103
Hpy166II GTNNAC 1 cut(s) 139
Hpy8I GTNNAC 1 cut(s) 139
LmnI GCTCC 1 cut(s) 105
LpnPI CCDG 7 cut(s) 42, 63, 69, 77, 83, 90, 189
LweI GCATC 1 cut(s) 198
MaeI CTAG 1 cut(s) 26
MboII GAAGA 1 cut(s) 142
MhlI GDGCHC 1 cut(s) 16
MlyI GAGTC 1 cut(s) 54
MnlI CCTC 1 cut(s) 158
MspR9I CCNGG 2 cut(s) 57, 78
MvaI CCWGG 2 cut(s) 57, 78
NlaIV GGNNCC 1 cut(s) 15
PfoI TCCNGGA 1 cut(s) 55
PleI GAGTC 1 cut(s) 54
PpsI GAGTC 1 cut(s) 54
Psp6I CCWGG 2 cut(s) 55, 76
PspGI CCWGG 2 cut(s) 55, 76
PspN4I GGNNCC 1 cut(s) 15
SchI GAGTC 1 cut(s) 54
ScrFI CCNGG 2 cut(s) 57, 78
SduI GDGCHC 1 cut(s) 16
SetI ASST 3 cut(s) 75, 79, 110
SfaNI GCATC 1 cut(s) 198
SspMI CTAG 1 cut(s) 26
StyD4I CCNGG 2 cut(s) 55, 76
XcmI CCANNNNNNNNNTGG 1 cut(s) 175
XspI CTAG 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.