Prupe.5G149600_v2.0.a1

Protein of unknown function (DUF3339)

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
Physical Location & Seq
Reverse (-)
13617475 .. 13617684
210 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G149600.1

Sequence Viewer

Length: 210 bp
ATGGTGGACTGGGCACCCGTTCTACTTGGGTTGATGTTGTTCATACTGCTGTCTCCTGGTCTTCTGTTTCAAATACCAGGAAACACCCGCCATGTTGAGTTTGGGAGCTTCACCACAAATGGCAAGGCCATTCTTGTCCACACACTCATTTTCTTTGTCATTTTCACCATCCTCATATTGGCTTTTGGCATCCACATCCACACTGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

7.63

Weight (kDa)

6.89

Isoelectric Point (pI)

28.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016502)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 13
AciI CCGC 1 cut(s) 88
AfiI CCNNNNNNNGG 1 cut(s) 178
AgsI TTSAA 1 cut(s) 71
AjnI CCWGG 2 cut(s) 55, 76
AluBI AGCT 1 cut(s) 108
AluI AGCT 1 cut(s) 108
Alw26I GTCTC 1 cut(s) 57
AoxI GGCC 1 cut(s) 126
AsuHPI GGTGA 2 cut(s) 103, 157
BaeGI GKGCMC 1 cut(s) 16
BanI GGYRCC 1 cut(s) 13
BbsI GAAGAC 1 cut(s) 53
BccI CCATC 1 cut(s) 176
BciT130I CCWGG 2 cut(s) 57, 78
BcoDI GTCTC 1 cut(s) 57
Bme1390I CCNGG 2 cut(s) 57, 78
BmiI GGNNCC 1 cut(s) 15
BmrFI CCNGG 2 cut(s) 57, 78
BmrI ACTGGG 1 cut(s) 19
BmsI GCATC 1 cut(s) 198
BmuI ACTGGG 1 cut(s) 19
BpiI GAAGAC 1 cut(s) 53
Bsc4I CCNNNNNNNGG 1 cut(s) 178
Bse1I ACTGG 2 cut(s) 14, 208
BseBI CCWGG 2 cut(s) 57, 78
BseGI GGATG 3 cut(s) 168, 189, 195
BseLI CCNNNNNNNGG 1 cut(s) 178
BseNI ACTGG 2 cut(s) 14, 208
BseSI GKGCMC 1 cut(s) 16
BshFI GGCC 1 cut(s) 128
BshNI GGYRCC 1 cut(s) 13
BslI CCNNNNNNNGG 1 cut(s) 178
BsmAI GTCTC 1 cut(s) 57
BsnI GGCC 1 cut(s) 128
Bsp1286I GDGCHC 1 cut(s) 16
BspACI CCGC 1 cut(s) 88
BspANI GGCC 1 cut(s) 128
BspLI GGNNCC 1 cut(s) 15
BspT107I GGYRCC 1 cut(s) 13
BsrI ACTGG 2 cut(s) 14, 208
Bst2UI CCWGG 2 cut(s) 57, 78
BstF5I GGATG 3 cut(s) 168, 189, 195
BstMAI GTCTC 1 cut(s) 57
BstNI CCWGG 2 cut(s) 57, 78
BstSCI CCNGG 2 cut(s) 55, 76
BstSLI GKGCMC 1 cut(s) 16
BstV2I GAAGAC 1 cut(s) 53
BsuRI GGCC 1 cut(s) 128
BtsCI GGATG 3 cut(s) 168, 189, 195
BtsIMutI CAGTG 1 cut(s) 201
CviAII CATG 1 cut(s) 92
CviJI RGCY 4 cut(s) 108, 128, 182, 207
CviKI_1 RGCY 4 cut(s) 108, 128, 182, 207
EcoRII CCWGG 2 cut(s) 55, 76
FaeI CATG 1 cut(s) 95
FaiI YATR 3 cut(s) 44, 93, 176
FatI CATG 1 cut(s) 91
FauI CCCGC 1 cut(s) 95
FokI GGATG 3 cut(s) 155, 176, 182
HaeIII GGCC 1 cut(s) 128
Hin1II CATG 1 cut(s) 95
HphI GGTGA 2 cut(s) 103, 157
Hpy166II GTNNAC 2 cut(s) 7, 139
Hpy8I GTNNAC 2 cut(s) 7, 139
Hsp92II CATG 1 cut(s) 95
LmnI GCTCC 1 cut(s) 105
LpnPI CCDG 5 cut(s) 42, 63, 69, 90, 189
LweI GCATC 1 cut(s) 198
MboII GAAGA 1 cut(s) 53
MhlI GDGCHC 1 cut(s) 16
MnlI CCTC 1 cut(s) 182
MspR9I CCNGG 2 cut(s) 57, 78
MvaI CCWGG 2 cut(s) 57, 78
NlaIII CATG 1 cut(s) 95
NlaIV GGNNCC 1 cut(s) 15
Psp6I CCWGG 2 cut(s) 55, 76
PspGI CCWGG 2 cut(s) 55, 76
PspN4I GGNNCC 1 cut(s) 15
ScrFI CCNGG 2 cut(s) 57, 78
SduI GDGCHC 1 cut(s) 16
SetI ASST 1 cut(s) 110
SfaNI GCATC 1 cut(s) 198
SsiI CCGC 1 cut(s) 88
StyD4I CCNGG 2 cut(s) 55, 76
TscAI CASTG 1 cut(s) 208
TspDTI ATGAA 1 cut(s) 31
TspRI CASTG 1 cut(s) 208
XcmI CCANNNNNNNNNTGG 3 cut(s) 98, 175, 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.