MD07G1189600.v1.1

Plant protein 1589 of unknown function (A_thal_3526)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
OG0006013
Physical Location & Seq
Reverse (-)
26986137 .. 26987882
1746 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1189600.v1.1.491

Sequence Viewer

Length: 285 bp
ATGGGAGATTCTTCATCAGCATCATACATACACATGGTGCAGCACCTGATAGAGAAGTGTTTGATCTACCACATGACCAAAGAGGAGTGCATGGAAGCTCTCTCTAAACATGCAAACATCCAACCTGTCATCACTTCTACTGTTTGGAATGAACTGGAGAAAGTGAACAAGGAGTTCTTCGAGGCGTATGAAGAGTCTCAGAACAAAGGAGATCGAATGTCAGAGGAAGAGACAAGCCAATTGATCCAAAAGATGCTATCGGATTCCAAAGATTCCGACGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
A_thal_3526

Protein Analysis

95

Amino Acids

10.88

Weight (kDa)

4.7

Isoelectric Point (pI)

79.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
A_thal_3526 PF09713 13 - 64 2.3e-26 Plant protein 1589 of unknown function (A_thal_3526)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 238
AdeI CACNNNGTG 1 cut(s) 37
AluBI AGCT 1 cut(s) 98
AluI AGCT 1 cut(s) 98
Alw26I GTCTC 2 cut(s) 201, 224
AlwI GGATC 1 cut(s) 238
AlwNI CAGNNNCTG 1 cut(s) 46
ApeKI GCWGC 1 cut(s) 40
BbvI GCAGC 1 cut(s) 52
BcoDI GTCTC 2 cut(s) 201, 224
BfaI CTAG 1 cut(s) 283
BisI GCNGC 1 cut(s) 41
BlsI GCNGC 1 cut(s) 42
BmsI GCATC 2 cut(s) 29, 243
BpmI CTGGAG 1 cut(s) 176
Bse1I ACTGG 1 cut(s) 159
BseGI GGATG 1 cut(s) 117
BseMII CTCAG 1 cut(s) 212
BseNI ACTGG 1 cut(s) 159
BseRI GAGGAG 1 cut(s) 98
BseXI GCAGC 1 cut(s) 52
BsgI GTGCAG 1 cut(s) 59
BsmAI GTCTC 2 cut(s) 201, 224
Bsp143I GATC 3 cut(s) 63, 211, 243
BspCNI CTCAG 1 cut(s) 211
BspPI GGATC 1 cut(s) 238
BsrI ACTGG 1 cut(s) 159
BssMI GATC 3 cut(s) 63, 211, 243
Bst4CI ACNGT 1 cut(s) 142
Bst6I CTCTTC 2 cut(s) 186, 222
BstDEI CTNAG 1 cut(s) 198
BstF5I GGATG 1 cut(s) 117
BstKTI GATC 3 cut(s) 66, 214, 246
BstMAI GTCTC 2 cut(s) 201, 224
BstMBI GATC 3 cut(s) 63, 211, 243
BstNSI RCATGY 1 cut(s) 113
BstV1I GCAGC 1 cut(s) 52
BtsCI GGATG 1 cut(s) 117
CaiI CAGNNNCTG 1 cut(s) 46
CviAII CATG 4 cut(s) 34, 73, 91, 110
CviJI RGCY 2 cut(s) 98, 237
CviKI_1 RGCY 2 cut(s) 98, 237
DdeI CTNAG 1 cut(s) 198
DpnI GATC 3 cut(s) 65, 213, 245
DpnII GATC 3 cut(s) 63, 211, 243
DraIII CACNNNGTG 1 cut(s) 37
Eam1104I CTCTTC 2 cut(s) 186, 222
EarI CTCTTC 2 cut(s) 186, 222
FaeI CATG 4 cut(s) 37, 76, 94, 113
FaiI YATR 7 cut(s) 25, 29, 35, 74, 92, 111, 189
FalI AAGNNNNNCTT 2 cut(s) 161, 193
FatI CATG 4 cut(s) 33, 72, 90, 109
Fnu4HI GCNGC 1 cut(s) 41
FokI GGATG 1 cut(s) 104
Fsp4HI GCNGC 1 cut(s) 41
FspBI CTAG 1 cut(s) 283
GluI GCNGC 1 cut(s) 41
GsuI CTGGAG 1 cut(s) 176
Hin1II CATG 4 cut(s) 37, 76, 94, 113
HinfI GANTC 4 cut(s) 8, 194, 263, 272
Hpy166II GTNNAC 1 cut(s) 166
Hpy188I TCNGA 4 cut(s) 201, 223, 262, 277
Hpy8I GTNNAC 1 cut(s) 166
Hpy99I CGWCG 1 cut(s) 281
HpyCH4III ACNGT 1 cut(s) 142
HpyCH4V TGCA 3 cut(s) 40, 90, 113
HpyF3I CTNAG 1 cut(s) 198
Hsp92II CATG 4 cut(s) 37, 76, 94, 113
Kzo9I GATC 3 cut(s) 63, 211, 243
LpnPI CCDG 3 cut(s) 59, 138, 140
Lsp1109I GCAGC 1 cut(s) 52
LweI GCATC 2 cut(s) 29, 243
MaeI CTAG 1 cut(s) 283
MalI GATC 3 cut(s) 65, 213, 245
MboI GATC 3 cut(s) 63, 211, 243
MboII GAAGA 4 cut(s) 3, 169, 203, 239
MfeI CAATTG 1 cut(s) 239
MluCI AATT 1 cut(s) 239
MlyI GAGTC 1 cut(s) 203
MmeI TCCRAC 1 cut(s) 145
MnlI CCTC 3 cut(s) 76, 175, 217
MslI CAYNNNNRTG 1 cut(s) 32
MunI CAATTG 1 cut(s) 239
NdeII GATC 3 cut(s) 63, 211, 243
NlaIII CATG 4 cut(s) 37, 76, 94, 113
NspI RCATGY 1 cut(s) 113
PfeI GAWTC 3 cut(s) 8, 263, 272
PkrI GCNGC 1 cut(s) 42
PleI GAGTC 1 cut(s) 202
PpsI GAGTC 1 cut(s) 202
PstNI CAGNNNCTG 1 cut(s) 46
RseI CAYNNNNRTG 1 cut(s) 32
SatI GCNGC 1 cut(s) 41
Sau3AI GATC 3 cut(s) 63, 211, 243
SchI GAGTC 1 cut(s) 203
SetI ASST 3 cut(s) 48, 100, 127
SfaNI GCATC 2 cut(s) 29, 243
SmiMI CAYNNNNRTG 1 cut(s) 32
Sse9I AATT 1 cut(s) 239
SspMI CTAG 1 cut(s) 283
TaaI ACNGT 1 cut(s) 142
TaqI TCGA 2 cut(s) 180, 214
TasI AATT 1 cut(s) 239
TfiI GAWTC 3 cut(s) 8, 263, 272
TseI GCWGC 1 cut(s) 40
TspDTI ATGAA 2 cut(s) 165, 204
XceI RCATGY 1 cut(s) 113
XspI CTAG 1 cut(s) 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.