MD07G1192700.v1.1

WAT1-related protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Forward (+)
27286974 .. 27287713
740 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1192700.v1.1.491

Sequence Viewer

Length: 165 bp
ATGTACCTTGGAAGTATTCTTGGAGCCATAGTCATATTTGTTGGGCTATATCTGGTTCTATGGGGGAAGAAGAAAGATAAACCTCCATCTCATTCATTAAAAAGTCAGAATCAAGCACTAGATGATGAAGAGATGACTACAAATCAGCAACAAATGGGAGTATGA

Protein Analysis

55

Amino Acids

6.02

Weight (kDa)

6.52

Isoelectric Point (pI)

27.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 5
BccI CCATC 1 cut(s) 94
BfaI CTAG 1 cut(s) 119
BmiI GGNNCC 1 cut(s) 25
BsaJI CCNNGG 1 cut(s) 7
BsaXI ACNNNNNCTCC 2 cut(s) 15, 45
BseDI CCNNGG 1 cut(s) 7
BspLI GGNNCC 1 cut(s) 25
BssECI CCNNGG 1 cut(s) 7
BssT1I CCWWGG 1 cut(s) 7
Bst6I CTCTTC 1 cut(s) 123
Csp6I GTAC 1 cut(s) 4
CviJI RGCY 2 cut(s) 26, 46
CviKI_1 RGCY 2 cut(s) 26, 46
CviQI GTAC 1 cut(s) 4
Eam1104I CTCTTC 1 cut(s) 123
EarI CTCTTC 1 cut(s) 123
Eco130I CCWWGG 1 cut(s) 7
EcoT14I CCWWGG 1 cut(s) 7
ErhI CCWWGG 1 cut(s) 7
FaiI YATR 5 cut(s) 29, 35, 49, 61, 163
FspBI CTAG 1 cut(s) 119
HinfI GANTC 1 cut(s) 109
Hpy188I TCNGA 1 cut(s) 108
LmnI GCTCC 1 cut(s) 23
LpnPI CCDG 1 cut(s) 38
MaeI CTAG 1 cut(s) 119
MboII GAAGA 3 cut(s) 79, 82, 140
MnlI CCTC 1 cut(s) 93
MseI TTAA 1 cut(s) 98
NlaIV GGNNCC 1 cut(s) 25
PfeI GAWTC 1 cut(s) 109
PspN4I GGNNCC 1 cut(s) 25
RsaI GTAC 1 cut(s) 5
RsaNI GTAC 1 cut(s) 4
SaqAI TTAA 1 cut(s) 98
SetI ASST 2 cut(s) 9, 85
SgeI CNNG 5 cut(s) 20, 32, 65, 125, 131
SspMI CTAG 1 cut(s) 119
StyI CCWWGG 1 cut(s) 7
TfiI GAWTC 1 cut(s) 109
Tru1I TTAA 1 cut(s) 98
Tru9I TTAA 1 cut(s) 98
TspDTI ATGAA 2 cut(s) 84, 141
XspI CTAG 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.