Rh7CG519100

F-box protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0016945
Physical Location & Seq
Reverse (-)
69773417 .. 69773758
342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG519100.1

Sequence Viewer

Length: 342 bp
ATGTGGTCCCTGGGCGTCATCTCCGACGATGATTCGTCACCCACCGCCTCCGCCTCCGACAAGTCACGCGCCCCCTTCTCGAGTTTGTTCCCGTTGGTCTTCGGCGACACTATCAAGCCTCTCCAGGCTCTCGCCCAATTTCTCGGTCCCCGCAGATCTTCCTCGTCGGCAAAATACGCTGAAATGGAGGGCCGATTTCGGGTCAATACTCAAACCCAGAAGCATTATAACTCAGCTCAATACTCAAATCTCCAAGAACCCACAAAAACCCAACTGTTAAAACATACACACCCCAAGTTAAAACGAGAATCACAATCAAACAAACCCCATTTGGATTCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box-like

Protein Analysis

113

Amino Acids

12.64

Weight (kDa)

9.69

Isoelectric Point (pI)

56.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 228
AccII CGCG 1 cut(s) 69
AciI CCGC 3 cut(s) 45, 51, 151
AcyI GRCGYC 1 cut(s) 15
AfiI CCNNNNNNNGG 1 cut(s) 199
AjnI CCWGG 2 cut(s) 9, 123
AluBI AGCT 1 cut(s) 236
AluI AGCT 1 cut(s) 236
Ama87I CYCGRG 1 cut(s) 79
AoxI GGCC 1 cut(s) 190
AspLEI GCGC 1 cut(s) 71
AspS9I GGNCC 3 cut(s) 6, 146, 190
AsuHPI GGTGA 1 cut(s) 30
AvaI CYCGRG 1 cut(s) 79
AvaII GGWCC 2 cut(s) 6, 146
BbsI GAAGAC 1 cut(s) 91
BciT130I CCWGG 2 cut(s) 11, 125
BfaI CTAG 1 cut(s) 340
BglII AGATCT 1 cut(s) 155
Bme1390I CCNGG 2 cut(s) 11, 125
Bme18I GGWCC 2 cut(s) 6, 146
BmeT110I CYCGRG 1 cut(s) 79
BmgT120I GGNCC 3 cut(s) 6, 146, 190
BmiI GGNNCC 2 cut(s) 8, 148
BmrFI CCNGG 2 cut(s) 11, 125
BpiI GAAGAC 1 cut(s) 91
BpmI CTGGAG 1 cut(s) 107
BsaHI GRCGYC 1 cut(s) 15
BsaJI CCNNGG 2 cut(s) 9, 10
Bsc4I CCNNNNNNNGG 1 cut(s) 199
BseBI CCWGG 2 cut(s) 11, 125
BseDI CCNNGG 2 cut(s) 9, 10
BseLI CCNNNNNNNGG 1 cut(s) 199
BseMII CTCAG 1 cut(s) 246
Bsh1236I CGCG 1 cut(s) 69
BshFI GGCC 1 cut(s) 192
BsiHKCI CYCGRG 1 cut(s) 79
BslFI GGGAC 1 cut(s) 132
BslI CCNNNNNNNGG 1 cut(s) 199
BsmFI GGGAC 1 cut(s) 132
BsnI GGCC 1 cut(s) 192
BsoBI CYCGRG 1 cut(s) 79
Bsp143I GATC 1 cut(s) 155
BspACI CCGC 3 cut(s) 45, 51, 151
BspANI GGCC 1 cut(s) 192
BspCNI CTCAG 1 cut(s) 245
BspFNI CGCG 1 cut(s) 69
BspLI GGNNCC 2 cut(s) 8, 148
BssECI CCNNGG 2 cut(s) 9, 10
BssMI GATC 1 cut(s) 155
BssNI GRCGYC 1 cut(s) 15
Bst2UI CCWGG 2 cut(s) 11, 125
Bst4CI ACNGT 1 cut(s) 276
BstACI GRCGYC 1 cut(s) 15
BstDEI CTNAG 1 cut(s) 232
BstFNI CGCG 1 cut(s) 69
BstHHI GCGC 1 cut(s) 71
BstKTI GATC 1 cut(s) 158
BstMBI GATC 1 cut(s) 155
BstMWI GCNNNNNNNGC 1 cut(s) 176
BstNI CCWGG 2 cut(s) 11, 125
BstSCI CCNGG 2 cut(s) 9, 123
BstUI CGCG 1 cut(s) 69
BstV2I GAAGAC 1 cut(s) 91
BstX2I RGATCY 1 cut(s) 155
BstYI RGATCY 1 cut(s) 155
BsuRI GGCC 1 cut(s) 192
CfoI GCGC 1 cut(s) 71
Cfr13I GGNCC 3 cut(s) 6, 146, 190
CseI GACGC 1 cut(s) 4
CviJI RGCY 4 cut(s) 118, 128, 192, 236
CviKI_1 RGCY 4 cut(s) 118, 128, 192, 236
DdeI CTNAG 1 cut(s) 232
DpnI GATC 1 cut(s) 157
DpnII GATC 1 cut(s) 155
EciI GGCGGA 1 cut(s) 40
Eco47I GGWCC 2 cut(s) 6, 146
Eco88I CYCGRG 1 cut(s) 79
EcoRII CCWGG 2 cut(s) 9, 123
FaiI YATR 2 cut(s) 228, 285
FaqI GGGAC 1 cut(s) 132
FauI CCCGC 1 cut(s) 158
FspBI CTAG 1 cut(s) 340
GlaI GCGC 1 cut(s) 70
GsuI CTGGAG 1 cut(s) 107
HaeIII GGCC 1 cut(s) 192
HgaI GACGC 1 cut(s) 4
HhaI GCGC 1 cut(s) 71
Hin1I GRCGYC 1 cut(s) 15
Hin6I GCGC 1 cut(s) 69
HinP1I GCGC 1 cut(s) 69
HinfI GANTC 3 cut(s) 32, 308, 335
HphI GGTGA 1 cut(s) 30
Hpy188I TCNGA 2 cut(s) 25, 58
Hpy188III TCNNGA 1 cut(s) 79
Hpy99I CGWCG 2 cut(s) 29, 169
HpyAV CCTTC 1 cut(s) 85
HpyCH4III ACNGT 1 cut(s) 276
HpyF10VI GCNNNNNNNGC 1 cut(s) 176
HpyF3I CTNAG 1 cut(s) 232
Hsp92I GRCGYC 1 cut(s) 15
HspAI GCGC 1 cut(s) 69
Kzo9I GATC 1 cut(s) 155
LpnPI CCDG 4 cut(s) 23, 110, 137, 230
MaeI CTAG 1 cut(s) 340
MaeIII GTNAC 2 cut(s) 36, 63
MalI GATC 1 cut(s) 157
MboI GATC 1 cut(s) 155
MboII GAAGA 2 cut(s) 91, 150
MflI RGATCY 1 cut(s) 155
MluCI AATT 1 cut(s) 137
MmeI TCCRAC 2 cut(s) 48, 81
MnlI CCTC 5 cut(s) 58, 64, 129, 172, 181
MseI TTAA 2 cut(s) 278, 299
MspR9I CCNGG 2 cut(s) 11, 125
MvaI CCWGG 2 cut(s) 11, 125
MvnI CGCG 1 cut(s) 69
MwoI GCNNNNNNNGC 1 cut(s) 176
NdeII GATC 1 cut(s) 155
NlaIV GGNNCC 2 cut(s) 8, 148
NmuCI GTSAC 2 cut(s) 36, 63
PaeR7I CTCGAG 1 cut(s) 79
PasI CCCWGGG 1 cut(s) 10
PfeI GAWTC 3 cut(s) 32, 308, 335
PsiI TTATAA 1 cut(s) 228
Psp6I CCWGG 2 cut(s) 9, 123
PspGI CCWGG 2 cut(s) 9, 123
PspN4I GGNNCC 2 cut(s) 8, 148
PspPI GGNCC 3 cut(s) 6, 146, 190
PsuI RGATCY 1 cut(s) 155
SaqAI TTAA 2 cut(s) 278, 299
Sau3AI GATC 1 cut(s) 155
Sau96I GGNCC 3 cut(s) 6, 146, 190
ScrFI CCNGG 2 cut(s) 11, 125
SetI ASST 1 cut(s) 238
Sfr274I CTCGAG 1 cut(s) 79
SinI GGWCC 2 cut(s) 6, 146
SlaI CTCGAG 1 cut(s) 79
SmlI CTYRAG 1 cut(s) 79
SmoI CTYRAG 1 cut(s) 79
Sse9I AATT 1 cut(s) 137
SsiI CCGC 3 cut(s) 45, 51, 151
SspMI CTAG 1 cut(s) 340
StyD4I CCNGG 2 cut(s) 9, 123
TaaI ACNGT 1 cut(s) 276
TaqI TCGA 1 cut(s) 80
TaqII GACCGA 1 cut(s) 134
TasI AATT 1 cut(s) 137
TfiI GAWTC 3 cut(s) 32, 308, 335
Tru1I TTAA 2 cut(s) 278, 299
Tru9I TTAA 2 cut(s) 278, 299
TseFI GTSAC 2 cut(s) 36, 63
Tsp45I GTSAC 2 cut(s) 36, 63
VpaK11BI GGWCC 2 cut(s) 6, 146
XhoI CTCGAG 1 cut(s) 79
XspI CTAG 1 cut(s) 340
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.