Rh2CG177900

generation of catalytic spliceosome for first transesterification step

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
16318377 .. 16319321
945 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG177900.1

Sequence Viewer

Length: 234 bp
ATGGCGTCGATTTCTAGTGGTCAAATTTTATCTACTCTTAGTGGTCATTCGAAGAAGGTTACCAGCGTTAAATTTGGAGGTCGCTATAATCTGGTCATAACCAAGTTGGCTGACAAGACGTTTTGCATGTCATTCAGTATGGTTATTGGGATGGCCATTAATAATTCTGCATACTCTATGATAGAGAGCTTAACATGGGGTTTTTGTTTAAAACATGGATCAACTAGAGTTTAA

Protein Analysis

77

Amino Acids

8.33

Weight (kDa)

9.83

Isoelectric Point (pI)

29.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 226
AcoI YGGCCR 1 cut(s) 153
AcsI RAATTY 2 cut(s) 24, 71
AcyI GRCGYC 1 cut(s) 5
AluBI AGCT 1 cut(s) 189
AluI AGCT 1 cut(s) 189
AlwI GGATC 1 cut(s) 226
AoxI GGCC 1 cut(s) 153
ApoI RAATTY 2 cut(s) 24, 71
AseI ATTAAT 1 cut(s) 159
AsuII TTCGAA 1 cut(s) 50
BalI TGGCCA 1 cut(s) 155
BccI CCATC 1 cut(s) 145
BfaI CTAG 2 cut(s) 15, 225
Bpu14I TTCGAA 1 cut(s) 50
BsaHI GRCGYC 1 cut(s) 5
BseGI GGATG 1 cut(s) 156
BshFI GGCC 1 cut(s) 155
BsnI GGCC 1 cut(s) 155
Bsp119I TTCGAA 1 cut(s) 50
Bsp143I GATC 1 cut(s) 218
BspANI GGCC 1 cut(s) 155
BspPI GGATC 1 cut(s) 226
BspT104I TTCGAA 1 cut(s) 50
BssMI GATC 1 cut(s) 218
BssNI GRCGYC 1 cut(s) 5
BstACI GRCGYC 1 cut(s) 5
BstBI TTCGAA 1 cut(s) 50
BstDEI CTNAG 1 cut(s) 38
BstEII GGTNACC 1 cut(s) 58
BstF5I GGATG 1 cut(s) 156
BstKTI GATC 1 cut(s) 221
BstMBI GATC 1 cut(s) 218
BstNSI RCATGY 1 cut(s) 130
BstPI GGTNACC 1 cut(s) 58
BsuRI GGCC 1 cut(s) 155
BtsCI GGATG 1 cut(s) 156
CviAII CATG 3 cut(s) 127, 195, 215
CviJI RGCY 3 cut(s) 110, 155, 189
CviKI_1 RGCY 3 cut(s) 110, 155, 189
DdeI CTNAG 1 cut(s) 38
DpnI GATC 1 cut(s) 220
DpnII GATC 1 cut(s) 218
DraI TTTAAA 1 cut(s) 210
EaeI YGGCCR 1 cut(s) 153
Eco91I GGTNACC 1 cut(s) 58
EcoO65I GGTNACC 1 cut(s) 58
FaeI CATG 3 cut(s) 130, 198, 218
FaiI YATR 8 cut(s) 87, 98, 128, 140, 172, 179, 196, 216
FatI CATG 3 cut(s) 126, 194, 214
FokI GGATG 1 cut(s) 163
FspBI CTAG 2 cut(s) 15, 225
HaeIII GGCC 1 cut(s) 155
Hin1I GRCGYC 1 cut(s) 5
Hin1II CATG 3 cut(s) 130, 198, 218
Hpy99I CGWCG 1 cut(s) 10
HpyAV CCTTC 1 cut(s) 49
HpyCH4IV ACGT 1 cut(s) 119
HpyCH4V TGCA 2 cut(s) 126, 170
HpyF3I CTNAG 1 cut(s) 38
HpySE526I ACGT 1 cut(s) 119
Hsp92I GRCGYC 1 cut(s) 5
Hsp92II CATG 3 cut(s) 130, 198, 218
Kzo9I GATC 1 cut(s) 218
LpnPI CCDG 2 cut(s) 76, 77
MaeI CTAG 2 cut(s) 15, 225
MaeII ACGT 1 cut(s) 119
MaeIII GTNAC 1 cut(s) 58
MalI GATC 1 cut(s) 220
MboI GATC 1 cut(s) 218
MboII GAAGA 1 cut(s) 64
MlsI TGGCCA 1 cut(s) 155
MluCI AATT 3 cut(s) 24, 71, 163
MluNI TGGCCA 1 cut(s) 155
MnlI CCTC 1 cut(s) 71
Mox20I TGGCCA 1 cut(s) 155
MscI TGGCCA 1 cut(s) 155
MseI TTAA 5 cut(s) 69, 159, 191, 209, 232
Msp20I TGGCCA 1 cut(s) 155
NdeII GATC 1 cut(s) 218
NlaIII CATG 3 cut(s) 130, 198, 218
NspI RCATGY 1 cut(s) 130
NspV TTCGAA 1 cut(s) 50
PshBI ATTAAT 1 cut(s) 159
PspEI GGTNACC 1 cut(s) 58
SaqAI TTAA 5 cut(s) 69, 159, 191, 209, 232
Sau3AI GATC 1 cut(s) 218
SetI ASST 4 cut(s) 60, 82, 122, 191
SfuI TTCGAA 1 cut(s) 50
SgeI CNNG 8 cut(s) 27, 75, 104, 115, 127, 139, 207, 227
Sse9I AATT 3 cut(s) 24, 71, 163
SspMI CTAG 2 cut(s) 15, 225
TaiI ACGT 1 cut(s) 122
TaqI TCGA 2 cut(s) 8, 50
TasI AATT 3 cut(s) 24, 71, 163
Tru1I TTAA 5 cut(s) 69, 159, 191, 209, 232
Tru9I TTAA 5 cut(s) 69, 159, 191, 209, 232
VspI ATTAAT 1 cut(s) 159
XapI RAATTY 2 cut(s) 24, 71
XceI RCATGY 1 cut(s) 130
XspI CTAG 2 cut(s) 15, 225
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.