Rh4CG356500

F-box protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0016945
Physical Location & Seq
Forward (+)
61319987 .. 61320631
645 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG356500.1

Sequence Viewer

Length: 339 bp
ATGCGGTCCCTGGGCGTCATCTTCGACGATGATTCGTCACCCTCCGCCTCCGCCTCCGACAAGTCACACGCCCCCTTCTCGAGTCTGTTCTGGTTGGTCTTCGGCGATGTCAAGCCTCTCCAGGCTCTCGGCCAGTTTCTCGGTCCCCGCAGATCTTCCTCGTCGGCGAAATCCGCTGAAATGGAGGGCCGATTTCGGGTCAATACTCAAACCCAGAAGCATTATAACTCAGCTCAATACTCAAATCTCCAAGAACCCACAAAAACCCAACTGTTAAAACATACACACCCCAAGTTAAAACGAGAATCACAACCAAACAAATCCCATTTGGATTCCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
F-box-like

Protein Analysis

112

Amino Acids

12.52

Weight (kDa)

9.75

Isoelectric Point (pI)

59.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 225
AciI CCGC 5 cut(s) 4, 45, 51, 148, 174
AcoI YGGCCR 1 cut(s) 130
AcyI GRCGYC 1 cut(s) 15
AfiI CCNNNNNNNGG 1 cut(s) 196
AjnI CCWGG 2 cut(s) 9, 120
AluBI AGCT 1 cut(s) 233
AluI AGCT 1 cut(s) 233
Ama87I CYCGRG 1 cut(s) 79
AoxI GGCC 2 cut(s) 130, 187
AspS9I GGNCC 3 cut(s) 6, 143, 187
AsuHPI GGTGA 1 cut(s) 30
AvaI CYCGRG 1 cut(s) 79
AvaII GGWCC 2 cut(s) 6, 143
BbsI GAAGAC 1 cut(s) 91
BciT130I CCWGG 2 cut(s) 11, 122
BfaI CTAG 1 cut(s) 337
BglII AGATCT 1 cut(s) 152
Bme1390I CCNGG 2 cut(s) 11, 122
Bme18I GGWCC 2 cut(s) 6, 143
BmeT110I CYCGRG 1 cut(s) 79
BmgT120I GGNCC 3 cut(s) 6, 143, 187
BmiI GGNNCC 2 cut(s) 8, 145
BmrFI CCNGG 2 cut(s) 11, 122
BpiI GAAGAC 1 cut(s) 91
BpmI CTGGAG 1 cut(s) 104
BsaHI GRCGYC 1 cut(s) 15
BsaJI CCNNGG 2 cut(s) 9, 10
Bsc4I CCNNNNNNNGG 1 cut(s) 196
Bse1I ACTGG 1 cut(s) 133
BseBI CCWGG 2 cut(s) 11, 122
BseDI CCNNGG 2 cut(s) 9, 10
BseLI CCNNNNNNNGG 1 cut(s) 196
BseMII CTCAG 1 cut(s) 243
BseNI ACTGG 1 cut(s) 133
BshFI GGCC 2 cut(s) 132, 189
BsiHKCI CYCGRG 1 cut(s) 79
BslFI GGGAC 1 cut(s) 129
BslI CCNNNNNNNGG 1 cut(s) 196
BsmFI GGGAC 1 cut(s) 129
BsnI GGCC 2 cut(s) 132, 189
BsoBI CYCGRG 1 cut(s) 79
Bsp143I GATC 1 cut(s) 152
BspACI CCGC 5 cut(s) 4, 45, 51, 148, 174
BspANI GGCC 2 cut(s) 132, 189
BspCNI CTCAG 1 cut(s) 242
BspLI GGNNCC 2 cut(s) 8, 145
BsrI ACTGG 1 cut(s) 133
BssECI CCNNGG 2 cut(s) 9, 10
BssMI GATC 1 cut(s) 152
BssNI GRCGYC 1 cut(s) 15
Bst2UI CCWGG 2 cut(s) 11, 122
Bst4CI ACNGT 1 cut(s) 273
BstACI GRCGYC 1 cut(s) 15
BstDEI CTNAG 1 cut(s) 229
BstKTI GATC 1 cut(s) 155
BstMBI GATC 1 cut(s) 152
BstMWI GCNNNNNNNGC 1 cut(s) 173
BstNI CCWGG 2 cut(s) 11, 122
BstSCI CCNGG 2 cut(s) 9, 120
BstV2I GAAGAC 1 cut(s) 91
BstX2I RGATCY 1 cut(s) 152
BstYI RGATCY 1 cut(s) 152
BsuRI GGCC 2 cut(s) 132, 189
BtgZI GCGATG 1 cut(s) 120
Cfr13I GGNCC 3 cut(s) 6, 143, 187
CseI GACGC 1 cut(s) 4
CviJI RGCY 5 cut(s) 115, 125, 132, 189, 233
CviKI_1 RGCY 5 cut(s) 115, 125, 132, 189, 233
DdeI CTNAG 1 cut(s) 229
DpnI GATC 1 cut(s) 154
DpnII GATC 1 cut(s) 152
EaeI YGGCCR 1 cut(s) 130
EciI GGCGGA 2 cut(s) 34, 40
Eco47I GGWCC 2 cut(s) 6, 143
Eco88I CYCGRG 1 cut(s) 79
EcoRII CCWGG 2 cut(s) 9, 120
FaiI YATR 2 cut(s) 225, 282
FaqI GGGAC 1 cut(s) 129
FauI CCCGC 1 cut(s) 155
FspBI CTAG 1 cut(s) 337
GsuI CTGGAG 1 cut(s) 104
HaeIII GGCC 2 cut(s) 132, 189
HgaI GACGC 1 cut(s) 4
Hin1I GRCGYC 1 cut(s) 15
HinfI GANTC 4 cut(s) 32, 82, 305, 332
HphI GGTGA 1 cut(s) 30
Hpy188I TCNGA 1 cut(s) 58
Hpy188III TCNNGA 1 cut(s) 79
Hpy99I CGWCG 2 cut(s) 29, 166
HpyAV CCTTC 1 cut(s) 85
HpyCH4III ACNGT 1 cut(s) 273
HpyF10VI GCNNNNNNNGC 1 cut(s) 173
HpyF3I CTNAG 1 cut(s) 229
Hsp92I GRCGYC 1 cut(s) 15
Kzo9I GATC 1 cut(s) 152
LpnPI CCDG 6 cut(s) 23, 76, 107, 134, 146, 227
MaeI CTAG 1 cut(s) 337
MaeIII GTNAC 2 cut(s) 36, 63
MalI GATC 1 cut(s) 154
MboI GATC 1 cut(s) 152
MboII GAAGA 3 cut(s) 13, 91, 147
MflI RGATCY 1 cut(s) 152
MlyI GAGTC 1 cut(s) 91
MmeI TCCRAC 1 cut(s) 81
MnlI CCTC 6 cut(s) 52, 58, 64, 126, 169, 178
MseI TTAA 2 cut(s) 275, 296
MspA1I CMGCKG 1 cut(s) 176
MspR9I CCNGG 2 cut(s) 11, 122
MvaI CCWGG 2 cut(s) 11, 122
MwoI GCNNNNNNNGC 1 cut(s) 173
NdeII GATC 1 cut(s) 152
NlaIV GGNNCC 2 cut(s) 8, 145
NmeAIII GCCGAG 1 cut(s) 108
NmuCI GTSAC 2 cut(s) 36, 63
PaeR7I CTCGAG 1 cut(s) 79
PasI CCCWGGG 1 cut(s) 10
PfeI GAWTC 3 cut(s) 32, 305, 332
PleI GAGTC 1 cut(s) 90
PpsI GAGTC 1 cut(s) 90
PsiI TTATAA 1 cut(s) 225
Psp6I CCWGG 2 cut(s) 9, 120
PspGI CCWGG 2 cut(s) 9, 120
PspN4I GGNNCC 2 cut(s) 8, 145
PspPI GGNCC 3 cut(s) 6, 143, 187
PsuI RGATCY 1 cut(s) 152
SaqAI TTAA 2 cut(s) 275, 296
Sau3AI GATC 1 cut(s) 152
Sau96I GGNCC 3 cut(s) 6, 143, 187
SchI GAGTC 1 cut(s) 91
ScrFI CCNGG 2 cut(s) 11, 122
SetI ASST 1 cut(s) 235
Sfr274I CTCGAG 1 cut(s) 79
SinI GGWCC 2 cut(s) 6, 143
SlaI CTCGAG 1 cut(s) 79
SmlI CTYRAG 1 cut(s) 79
SmoI CTYRAG 1 cut(s) 79
SsiI CCGC 5 cut(s) 4, 45, 51, 148, 174
SspMI CTAG 1 cut(s) 337
StyD4I CCNGG 2 cut(s) 9, 120
TaaI ACNGT 1 cut(s) 273
TaqI TCGA 2 cut(s) 24, 80
TaqII GACCGA 1 cut(s) 131
TfiI GAWTC 3 cut(s) 32, 305, 332
Tru1I TTAA 2 cut(s) 275, 296
Tru9I TTAA 2 cut(s) 275, 296
TseFI GTSAC 2 cut(s) 36, 63
Tsp45I GTSAC 2 cut(s) 36, 63
VpaK11BI GGWCC 2 cut(s) 6, 143
XhoI CTCGAG 1 cut(s) 79
XspI CTAG 1 cut(s) 337
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.