Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr11

Orthogroup ID

OG0012379

Physical Location & Seq

Genomic Coordinates Reverse (-)

4479126 .. 4479290

Gene Structure 165 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD11G1052400.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 165 bp

ATGGAGGACCACGTTCTAAAGCCTGAGCTGGAAGATGCCATGATCAAGAGATGGCCACCATCCCAAGTCTTTGTTCTCCATAGCGATCATATCCCCTTTTTCTCCACCCCCATTTTGCTCTTTGGTTTGTTGGTTAAAGCATCGACTTCCATCAAATGTGCTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0006082 GO:0006725 GO:0006807 GO:0007275 GO:0008150 GO:0008152 GO:0009683 GO:0009850 GO:0009987 GO:0010817 GO:0016787 GO:0016788 GO:0019752 GO:0032501 GO:0032502 GO:0032787 GO:0033473 GO:0034641 GO:0034754 GO:0042430 GO:0042445 GO:0043436 GO:0044237 GO:0044281 GO:0046483 GO:0048367 GO:0048731 GO:0048856 GO:0052689 GO:0065007 GO:0065008 GO:0071704 GO:0080030 GO:1901360 GO:1901564

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Abhydrolase_1 Abhydrolase_6

Protein Analysis

55

Amino Acids

6.13

Weight (kDa)

6.23

Isoelectric Point (pI)

54.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012379)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G10870
fragaria_vesca	FvH4_7g26180
malus_domestica	MD01G1170100.v1.1 MD07G1237000.v1.1 MD11G1052400.v1.1
prunus_persica	Prupe.2G266100_v2.0.a1
pyrus_communis	pycom01g18280 pycom07g21330
rosa_chinensis	RchiOBHm_Chr1g0372631
rosa_laevigata	RLG00000026885
rosa_multiflora	Rmu_sc0008757.1_g000010 Rmu_ssc0000419.1_g000007
rosa_roxburghii	Rroxscaffold_4G00284810
rosa_rugosa	Rorug01G0373400
rosa_samantha	Rh1AG381900 Rh1BG345300 Rh1CG358700 Rh1DG376500
rosa_wichuraiana	Rw1G033590

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	53
AjuI	GAANNNNNNNTTGG	2 cut(s)	57, 89
AluBI	AGCT	1 cut(s)	28
AluI	AGCT	1 cut(s)	28
AoxI	GGCC	1 cut(s)	53
AspS9I	GGNCC	1 cut(s)	7
AvaII	GGWCC	1 cut(s)	7
BalI	TGGCCA	1 cut(s)	55
BccI	CCATC	3 cut(s)	45, 67, 158
BclI	TGATCA	1 cut(s)	42
Bme18I	GGWCC	1 cut(s)	7
BmgT120I	GGNCC	1 cut(s)	7
BmsI	GCATC	2 cut(s)	25, 149
Bpu10I	CCTNAGC	1 cut(s)	24
BseGI	GGATG	1 cut(s)	59
BseMII	CTCAG	1 cut(s)	15
BshFI	GGCC	1 cut(s)	55
BsnI	GGCC	1 cut(s)	55
Bsp143I	GATC	2 cut(s)	42, 85
BspANI	GGCC	1 cut(s)	55
BspCNI	CTCAG	1 cut(s)	16
BssMI	GATC	2 cut(s)	42, 85
BstDEI	CTNAG	1 cut(s)	24
BstF5I	GGATG	1 cut(s)	59
BstKTI	GATC	2 cut(s)	45, 88
BstMBI	GATC	2 cut(s)	42, 85
BsuRI	GGCC	1 cut(s)	55
BtsCI	GGATG	1 cut(s)	59
Cfr13I	GGNCC	1 cut(s)	7
CviAII	CATG	1 cut(s)	40
CviJI	RGCY	3 cut(s)	22, 28, 55
CviKI_1	RGCY	3 cut(s)	22, 28, 55
DdeI	CTNAG	1 cut(s)	24
DpnI	GATC	2 cut(s)	44, 87
DpnII	GATC	2 cut(s)	42, 85
EaeI	YGGCCR	1 cut(s)	53
Eco47I	GGWCC	1 cut(s)	7
FaeI	CATG	1 cut(s)	43
FaiI	YATR	3 cut(s)	41, 81, 90
FatI	CATG	1 cut(s)	39
FbaI	TGATCA	1 cut(s)	42
FokI	GGATG	1 cut(s)	46
HaeIII	GGCC	1 cut(s)	55
Hin1II	CATG	1 cut(s)	43
Hpy188III	TCNNGA	1 cut(s)	46
HpyCH4IV	ACGT	1 cut(s)	12
HpyF3I	CTNAG	1 cut(s)	24
HpySE526I	ACGT	1 cut(s)	12
Hsp92II	CATG	1 cut(s)	43
Ksp22I	TGATCA	1 cut(s)	42
Kzo9I	GATC	2 cut(s)	42, 85
LpnPI	CCDG	2 cut(s)	14, 36
LweI	GCATC	2 cut(s)	25, 149
MaeII	ACGT	1 cut(s)	12
MalI	GATC	2 cut(s)	44, 87
MboI	GATC	2 cut(s)	42, 85
MboII	GAAGA	1 cut(s)	44
MlsI	TGGCCA	1 cut(s)	55
MluNI	TGGCCA	1 cut(s)	55
Mox20I	TGGCCA	1 cut(s)	55
MscI	TGGCCA	1 cut(s)	55
MseI	TTAA	2 cut(s)	135, 163
Msp20I	TGGCCA	1 cut(s)	55
NdeII	GATC	2 cut(s)	42, 85
NlaIII	CATG	1 cut(s)	43
PspPI	GGNCC	1 cut(s)	7
SaqAI	TTAA	2 cut(s)	135, 163
Sau3AI	GATC	2 cut(s)	42, 85
Sau96I	GGNCC	1 cut(s)	7
SetI	ASST	2 cut(s)	15, 30
SfaNI	GCATC	2 cut(s)	25, 149
SgeI	CNNG	6 cut(s)	23, 35, 41, 52, 58, 77
SinI	GGWCC	1 cut(s)	7
TaiI	ACGT	1 cut(s)	15
TaqI	TCGA	1 cut(s)	143
Tru1I	TTAA	2 cut(s)	135, 163
Tru9I	TTAA	2 cut(s)	135, 163
VpaK11BI	GGWCC	1 cut(s)	7

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.