MD12G1083400.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
OG0006655
Physical Location & Seq
Forward (+)
10116318 .. 10119442
3125 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1083400.v1.1.491

Sequence Viewer

Length: 426 bp
ATGGAGTCCAAGCAAGATGAAGTTGTACATGATAAGAACGAAACCAAGACAAGGAATGAAGTAGCTGATTCCAATCTATCAAAGGCTGATGGAAGATATGTTTTGGAACCCTTCGCTAGTTCACTAGACAATAGAGTACAGCCTAACTTGATTGATTTGGGAGGTGGAATTAATCTCACACATGACGCACCTTCTGTTTATAAGGATGCAACTGCTGAAGTGAATATGGAGGCATCGATAACATCTGATGATGTTATGCGGGCTGGAGGCTTTGGTGCTAGAGATGATATTAGTAGTTTTCTTCCCGTTGCAAGTGATTCTACTGACTTTGAAGCCACAATACGTGATGCTCGAGGTTATGAAGAACCACAGGGAAATATCTGTAGGCCAGGTCTTGGCTGGAAAGAAGCTAAAGAAACAGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

142

Amino Acids

15.37

Weight (kDa)

4.48

Isoelectric Point (pI)

37.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 201
AccB7I CCANNNNNTGG 1 cut(s) 395
AciI CCGC 1 cut(s) 259
AcuI CTGAAG 1 cut(s) 237
AfaI GTAC 2 cut(s) 27, 138
AfiI CCNNNNNNNGG 2 cut(s) 51, 395
AgsI TTSAA 1 cut(s) 332
AjnI CCWGG 1 cut(s) 388
AluBI AGCT 2 cut(s) 65, 410
AluI AGCT 2 cut(s) 65, 410
Ama87I CYCGRG 1 cut(s) 351
AoxI GGCC 1 cut(s) 386
AseI ATTAAT 1 cut(s) 171
AvaI CYCGRG 1 cut(s) 351
BarI GAAGNNNNNNTAC 2 cut(s) 324, 356
BccI CCATC 1 cut(s) 83
BciT130I CCWGG 1 cut(s) 390
BfaI CTAG 3 cut(s) 117, 125, 279
BfmI CTRYAG 1 cut(s) 382
Bme1390I CCNGG 1 cut(s) 390
BmeT110I CYCGRG 1 cut(s) 351
BmiI GGNNCC 1 cut(s) 108
BmrFI CCNGG 1 cut(s) 390
BmsI GCATC 3 cut(s) 196, 242, 337
BpmI CTGGAG 1 cut(s) 285
Bsa29I ATCGAT 1 cut(s) 236
BsaAI YACGTR 1 cut(s) 344
BsaBI GATNNNNATC 1 cut(s) 72
Bsc4I CCNNNNNNNGG 2 cut(s) 51, 395
Bse8I GATNNNNATC 1 cut(s) 72
BseBI CCWGG 1 cut(s) 390
BseCI ATCGAT 1 cut(s) 236
BseGI GGATG 1 cut(s) 211
BseJI GATNNNNATC 1 cut(s) 72
BseLI CCNNNNNNNGG 2 cut(s) 51, 395
BshFI GGCC 1 cut(s) 388
BshVI ATCGAT 1 cut(s) 236
BsiHKCI CYCGRG 1 cut(s) 351
BslI CCNNNNNNNGG 2 cut(s) 51, 395
BsnI GGCC 1 cut(s) 388
BsoBI CYCGRG 1 cut(s) 351
Bsp1407I TGTACA 1 cut(s) 25
BspACI CCGC 1 cut(s) 259
BspANI GGCC 1 cut(s) 388
BspDI ATCGAT 1 cut(s) 236
BspLI GGNNCC 1 cut(s) 108
BsrGI TGTACA 1 cut(s) 25
Bst2UI CCWGG 1 cut(s) 390
BstAUI TGTACA 1 cut(s) 25
BstBAI YACGTR 1 cut(s) 344
BstC8I GCNNGC 1 cut(s) 261
BstF5I GGATG 1 cut(s) 211
BstNI CCWGG 1 cut(s) 390
BstSCI CCNGG 1 cut(s) 388
BstSFI CTRYAG 1 cut(s) 382
Bsu15I ATCGAT 1 cut(s) 236
BsuRI GGCC 1 cut(s) 388
BsuTUI ATCGAT 1 cut(s) 236
BtsCI GGATG 1 cut(s) 211
Cac8I GCNNGC 1 cut(s) 261
ClaI ATCGAT 1 cut(s) 236
CseI GACGC 1 cut(s) 194
Csp6I GTAC 2 cut(s) 26, 137
CviAII CATG 2 cut(s) 29, 182
CviJI RGCY 9 cut(s) 65, 86, 142, 263, 270, 335, 388, 399, 410
CviKI_1 RGCY 9 cut(s) 65, 86, 142, 263, 270, 335, 388, 399, 410
CviQI GTAC 2 cut(s) 26, 137
Eco57I CTGAAG 1 cut(s) 237
Eco88I CYCGRG 1 cut(s) 351
EcoRII CCWGG 1 cut(s) 388
FaeI CATG 2 cut(s) 32, 185
FaiI YATR 7 cut(s) 30, 99, 183, 201, 227, 257, 360
FatI CATG 2 cut(s) 28, 181
FauI CCCGC 1 cut(s) 252
FokI GGATG 1 cut(s) 218
FspBI CTAG 3 cut(s) 117, 125, 279
GsuI CTGGAG 1 cut(s) 285
HaeIII GGCC 1 cut(s) 388
HgaI GACGC 1 cut(s) 194
Hin1II CATG 2 cut(s) 32, 185
HinfI GANTC 3 cut(s) 5, 68, 317
Hpy166II GTNNAC 1 cut(s) 122
Hpy188I TCNGA 1 cut(s) 247
Hpy8I GTNNAC 1 cut(s) 122
HpyAV CCTTC 2 cut(s) 121, 201
HpyCH4IV ACGT 1 cut(s) 343
HpyCH4V TGCA 2 cut(s) 209, 311
HpySE526I ACGT 1 cut(s) 343
Hsp92II CATG 2 cut(s) 32, 185
LpnPI CCDG 5 cut(s) 249, 356, 375, 385, 402
LweI GCATC 3 cut(s) 196, 242, 337
MaeI CTAG 3 cut(s) 117, 125, 279
MaeII ACGT 1 cut(s) 343
MboII GAAGA 3 cut(s) 105, 293, 374
MluCI AATT 1 cut(s) 168
MlyI GAGTC 1 cut(s) 14
MnlI CCTC 4 cut(s) 155, 223, 260, 347
MseI TTAA 1 cut(s) 171
MspR9I CCNGG 1 cut(s) 390
MvaI CCWGG 1 cut(s) 390
NlaIII CATG 2 cut(s) 32, 185
NlaIV GGNNCC 1 cut(s) 108
PaeR7I CTCGAG 1 cut(s) 351
PcsI WCGNNNNNNNCGW 1 cut(s) 349
PfeI GAWTC 2 cut(s) 68, 317
PflMI CCANNNNNTGG 1 cut(s) 395
PleI GAGTC 1 cut(s) 13
PpsI GAGTC 1 cut(s) 13
Ppu21I YACGTR 1 cut(s) 344
PshBI ATTAAT 1 cut(s) 171
PsiI TTATAA 1 cut(s) 201
Psp6I CCWGG 1 cut(s) 388
PspGI CCWGG 1 cut(s) 388
PspN4I GGNNCC 1 cut(s) 108
PspXI VCTCGAGB 1 cut(s) 351
RsaI GTAC 2 cut(s) 27, 138
RsaNI GTAC 2 cut(s) 26, 137
SaqAI TTAA 1 cut(s) 171
SchI GAGTC 1 cut(s) 14
ScrFI CCNGG 1 cut(s) 390
SetI ASST 7 cut(s) 67, 166, 193, 346, 358, 394, 412
SfaNI GCATC 3 cut(s) 196, 242, 337
SfcI CTRYAG 1 cut(s) 382
Sfr274I CTCGAG 1 cut(s) 351
SlaI CTCGAG 1 cut(s) 351
SmlI CTYRAG 1 cut(s) 351
SmoI CTYRAG 1 cut(s) 351
Sse9I AATT 1 cut(s) 168
SsiI CCGC 1 cut(s) 259
SspMI CTAG 3 cut(s) 117, 125, 279
StyD4I CCNGG 1 cut(s) 388
TaiI ACGT 1 cut(s) 346
TaqI TCGA 2 cut(s) 236, 352
TasI AATT 1 cut(s) 168
TatI WGTACW 2 cut(s) 25, 136
TfiI GAWTC 2 cut(s) 68, 317
Tru1I TTAA 1 cut(s) 171
Tru9I TTAA 1 cut(s) 171
TspDTI ATGAA 3 cut(s) 33, 72, 375
Van91I CCANNNNNTGG 1 cut(s) 395
VspI ATTAAT 1 cut(s) 171
XcmI CCANNNNNNNNNTGG 1 cut(s) 396
XhoI CTCGAG 1 cut(s) 351
XspI CTAG 3 cut(s) 117, 125, 279
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.