Rroxscaffold_6G00397940

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Reverse (-)
19776881 .. 19781684
4804 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00397940.1

Sequence Viewer

Length: 390 bp
ATGGAGCGCAAGCAAGATGAAGTTCTGCATGATAAGGATGAAAACCAGACAAGGAATGAGGAAGGTGTAACATATCAAATTCCTGTTTTGAAACCGTTCTCAAGTTCTCCAGGTATTGAAGTGCAAGCTAAGGCGGTTGATTGGGGAGGTGGAAAACACATTGTACCTTCTGGAGATATAGATGCCTCTGGTGAAGTAAATATGGAGGCATCAATAACACCTGATGACGTTATACGGGCTGGAGGCTTTGGTGCTAGAGATGATATAAGTAGGTTTCTTCCTGTCGCGAGTGATTCTACTGATTTTGAAGCTACAATACGTGATGCCCGAGACTATGAAGAACCACAGGGAGATATCTGTAGACCAGGTCTTGGCTGGACGAAAAGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

129

Amino Acids

14.09

Weight (kDa)

4.44

Isoelectric Point (pI)

41.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 371
AccI GTMKAC 1 cut(s) 361
AccII CGCG 1 cut(s) 287
AciI CCGC 1 cut(s) 134
AcsI RAATTY 1 cut(s) 78
AfaI GTAC 1 cut(s) 165
AfiI CCNNNNNNNGG 1 cut(s) 371
AgsI TTSAA 3 cut(s) 91, 119, 308
AjnI CCWGG 2 cut(s) 109, 364
AluBI AGCT 3 cut(s) 128, 311, 387
AluI AGCT 3 cut(s) 128, 311, 387
Alw26I GTCTC 1 cut(s) 324
Ama87I CYCGRG 1 cut(s) 327
ApoI RAATTY 1 cut(s) 78
Asp700I GAANNNNTTC 1 cut(s) 95
AspLEI GCGC 1 cut(s) 9
AsuHPI GGTGA 1 cut(s) 203
AvaI CYCGRG 1 cut(s) 327
BarI GAAGNNNNNNTAC 2 cut(s) 300, 332
BciT130I CCWGG 2 cut(s) 111, 366
BcoDI GTCTC 1 cut(s) 324
BfaI CTAG 2 cut(s) 255, 388
BfmI CTRYAG 1 cut(s) 358
Bme1390I CCNGG 2 cut(s) 111, 366
BmeT110I CYCGRG 1 cut(s) 327
BmrFI CCNGG 2 cut(s) 111, 366
BmsI GCATC 3 cut(s) 172, 218, 313
BpmI CTGGAG 3 cut(s) 93, 192, 261
Bpu10I CCTNAGC 1 cut(s) 129
BpuEI CTTGAG 1 cut(s) 85
BsaAI YACGTR 1 cut(s) 320
Bsc4I CCNNNNNNNGG 1 cut(s) 371
BseBI CCWGG 2 cut(s) 111, 366
BseGI GGATG 1 cut(s) 43
BseLI CCNNNNNNNGG 1 cut(s) 371
Bsh1236I CGCG 1 cut(s) 287
BsiHKCI CYCGRG 1 cut(s) 327
BslI CCNNNNNNNGG 1 cut(s) 371
BsmAI GTCTC 1 cut(s) 324
BsoBI CYCGRG 1 cut(s) 327
Bsp68I TCGCGA 1 cut(s) 287
BspACI CCGC 1 cut(s) 134
BspFNI CGCG 1 cut(s) 287
Bst2UI CCWGG 2 cut(s) 111, 366
Bst4CI ACNGT 1 cut(s) 96
BstBAI YACGTR 1 cut(s) 320
BstC8I GCNNGC 2 cut(s) 11, 126
BstDEI CTNAG 1 cut(s) 129
BstF5I GGATG 1 cut(s) 43
BstFNI CGCG 1 cut(s) 287
BstHHI GCGC 1 cut(s) 9
BstMAI GTCTC 1 cut(s) 324
BstNI CCWGG 2 cut(s) 111, 366
BstSCI CCNGG 2 cut(s) 109, 364
BstSFI CTRYAG 1 cut(s) 358
BstUI CGCG 1 cut(s) 287
BtsCI GGATG 1 cut(s) 43
BtuMI TCGCGA 1 cut(s) 287
Cac8I GCNNGC 2 cut(s) 11, 126
CfoI GCGC 1 cut(s) 9
CsiI ACCWGGT 1 cut(s) 364
Csp6I GTAC 1 cut(s) 164
CviAII CATG 1 cut(s) 29
CviJI RGCY 6 cut(s) 128, 239, 246, 311, 375, 387
CviKI_1 RGCY 6 cut(s) 128, 239, 246, 311, 375, 387
CviQI GTAC 1 cut(s) 164
DdeI CTNAG 1 cut(s) 129
Eco32I GATATC 1 cut(s) 355
Eco88I CYCGRG 1 cut(s) 327
EcoRII CCWGG 2 cut(s) 109, 364
EcoRV GATATC 1 cut(s) 355
FaeI CATG 1 cut(s) 32
FaiI YATR 7 cut(s) 30, 73, 179, 203, 233, 266, 336
FatI CATG 1 cut(s) 28
FblI GTMKAC 1 cut(s) 361
FokI GGATG 1 cut(s) 50
FspBI CTAG 2 cut(s) 255, 388
GlaI GCGC 1 cut(s) 8
GsuI CTGGAG 3 cut(s) 93, 192, 261
HhaI GCGC 1 cut(s) 9
Hin1II CATG 1 cut(s) 32
Hin6I GCGC 1 cut(s) 7
HinP1I GCGC 1 cut(s) 7
HinfI GANTC 1 cut(s) 293
HphI GGTGA 1 cut(s) 203
Hpy166II GTNNAC 1 cut(s) 362
Hpy188III TCNNGA 2 cut(s) 171, 286
Hpy8I GTNNAC 1 cut(s) 362
HpyAV CCTTC 2 cut(s) 56, 177
HpyCH4III ACNGT 1 cut(s) 96
HpyCH4IV ACGT 2 cut(s) 228, 319
HpyCH4V TGCA 2 cut(s) 28, 124
HpyF3I CTNAG 1 cut(s) 129
HpySE526I ACGT 2 cut(s) 228, 319
Hsp92II CATG 1 cut(s) 32
HspAI GCGC 1 cut(s) 7
LmnI GCTCC 1 cut(s) 4
LweI GCATC 3 cut(s) 172, 218, 313
MabI ACCWGGT 1 cut(s) 364
MaeI CTAG 2 cut(s) 255, 388
MaeII ACGT 2 cut(s) 228, 319
MaeIII GTNAC 1 cut(s) 67
MboII GAAGA 2 cut(s) 269, 350
MluCI AATT 1 cut(s) 78
MnlI CCTC 5 cut(s) 52, 140, 196, 199, 236
MroXI GAANNNNTTC 1 cut(s) 95
MspR9I CCNGG 2 cut(s) 111, 366
MvaI CCWGG 2 cut(s) 111, 366
MvnI CGCG 1 cut(s) 287
NlaIII CATG 1 cut(s) 32
NruI TCGCGA 1 cut(s) 287
PcsI WCGNNNNNNNCGW 1 cut(s) 325
PdmI GAANNNNTTC 1 cut(s) 95
PfeI GAWTC 1 cut(s) 293
PflFI GACNNNGTC 1 cut(s) 366
PflMI CCANNNNNTGG 1 cut(s) 371
Ppu21I YACGTR 1 cut(s) 320
Psp6I CCWGG 2 cut(s) 109, 364
PspGI CCWGG 2 cut(s) 109, 364
PsyI GACNNNGTC 1 cut(s) 366
RruI TCGCGA 1 cut(s) 287
RsaI GTAC 1 cut(s) 165
RsaNI GTAC 1 cut(s) 164
ScrFI CCNGG 2 cut(s) 111, 366
SexAI ACCWGGT 1 cut(s) 364
SfaNI GCATC 3 cut(s) 172, 218, 313
SfcI CTRYAG 1 cut(s) 358
SmlI CTYRAG 1 cut(s) 100
SmoI CTYRAG 1 cut(s) 100
Sse9I AATT 1 cut(s) 78
SsiI CCGC 1 cut(s) 134
SspMI CTAG 2 cut(s) 255, 388
StyD4I CCNGG 2 cut(s) 109, 364
TaaI ACNGT 1 cut(s) 96
TaiI ACGT 2 cut(s) 231, 322
TasI AATT 1 cut(s) 78
TfiI GAWTC 1 cut(s) 293
TspDTI ATGAA 3 cut(s) 33, 54, 351
Tth111I GACNNNGTC 1 cut(s) 366
Van91I CCANNNNNTGG 1 cut(s) 371
XapI RAATTY 1 cut(s) 78
XcmI CCANNNNNNNNNTGG 1 cut(s) 372
XmiI GTMKAC 1 cut(s) 361
XmnI GAANNNNTTC 1 cut(s) 95
XspI CTAG 2 cut(s) 255, 388
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.