MD13G1273400.v1.1

acyl- acyl-carrier-protein --UDP-N-acetylglucosamine O-acyltransferase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr13
OG0003927
Physical Location & Seq
Forward (+)
37021356 .. 37021808
453 bp
Loading structure...
UTR
Exon/CDS
Intron
MD13G1273400.v1.1.491

Sequence Viewer

Length: 453 bp
ATGGGATCTTGTCATATTGCCCACGATTGCAAGATCGAAAACAACATCAATTTTGCAAATAATACATTGCTGGAAGGCCATGTTGTGGTAGAAGATTATGCTCACACTGCAGGGGCTATCGTCGTTCATCAATTTTTCCATGTTGGCTCTTTCTCATTTATTGGTGGTGGCTCTGTGATCGCACAGGATGTTCCAAAGTACATGATGGTTGCGGGAGAAAGAGCTGTGCTTCGTGGTTTAAACCTTGAAGGTCTATGCTGTAATGGATTCACAGCTACAGAGATCAGAAGCTTGAGAACAACTTACCAAAAGATATTCATGCCTGCTGATAAAAATTCCAGGGATTTTGAAGAACATCTTTCTGCTCATATACCTGTAGTCCATTCCATAGTGCAGTCTATCCGTGACTCTTTTGAAGAAAAGCAACATAGAATATGTAAATTCAGACATTGA

Protein Analysis

151

Amino Acids

16.81

Weight (kDa)

6.58

Isoelectric Point (pI)

50.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Acetyltransf_11 PF13720 63 - 137 2.8e-14 Udp N-acetylglucosamine O-acyltransferase; Domain 2
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 85
AciI CCGC 1 cut(s) 212
AclWI GGATC 1 cut(s) 13
AcsI RAATTY 2 cut(s) 334, 440
AfaI GTAC 1 cut(s) 200
AfiI CCNNNNNNNGG 1 cut(s) 85
AgsI TTSAA 3 cut(s) 248, 350, 416
AjnI CCWGG 1 cut(s) 338
AluBI AGCT 3 cut(s) 224, 275, 291
AluI AGCT 3 cut(s) 224, 275, 291
AlwI GGATC 1 cut(s) 13
AoxI GGCC 1 cut(s) 76
ApoI RAATTY 2 cut(s) 334, 440
BccI CCATC 1 cut(s) 199
BciT130I CCWGG 1 cut(s) 340
BfmI CTRYAG 3 cut(s) 108, 276, 375
Bme1390I CCNGG 1 cut(s) 340
BmrFI CCNGG 1 cut(s) 340
BpuEI CTTGAG 1 cut(s) 313
BsaJI CCNNGG 1 cut(s) 339
Bsc4I CCNNNNNNNGG 1 cut(s) 85
Bse3DI GCAATG 1 cut(s) 65
BseBI CCWGG 1 cut(s) 340
BseDI CCNNGG 1 cut(s) 339
BseGI GGATG 1 cut(s) 193
BseLI CCNNNNNNNGG 1 cut(s) 85
BseMI GCAATG 1 cut(s) 65
BsgI GTGCAG 1 cut(s) 413
BshFI GGCC 1 cut(s) 78
BslI CCNNNNNNNGG 1 cut(s) 85
BsnI GGCC 1 cut(s) 78
Bsp143I GATC 4 cut(s) 5, 33, 177, 282
BspACI CCGC 1 cut(s) 212
BspANI GGCC 1 cut(s) 78
BspMAI CTGCAG 1 cut(s) 112
BspPI GGATC 1 cut(s) 13
BsrDI GCAATG 1 cut(s) 65
BssECI CCNNGG 1 cut(s) 339
BssMI GATC 4 cut(s) 5, 33, 177, 282
Bst2UI CCWGG 1 cut(s) 340
BstC8I GCNNGC 1 cut(s) 324
BstF5I GGATG 1 cut(s) 193
BstKTI GATC 4 cut(s) 8, 36, 180, 285
BstMBI GATC 4 cut(s) 5, 33, 177, 282
BstMWI GCNNNNNNNGC 1 cut(s) 107
BstNI CCWGG 1 cut(s) 340
BstSCI CCNGG 1 cut(s) 338
BstSFI CTRYAG 3 cut(s) 108, 276, 375
BstX2I RGATCY 1 cut(s) 5
BstYI RGATCY 1 cut(s) 5
BsuRI GGCC 1 cut(s) 78
BtsCI GGATG 1 cut(s) 193
BtsI GCAGTG 1 cut(s) 105
BtsIMutI CAGTG 1 cut(s) 105
Cac8I GCNNGC 1 cut(s) 324
Csp6I GTAC 1 cut(s) 199
CviAII CATG 4 cut(s) 80, 140, 202, 319
CviJI RGCY 7 cut(s) 78, 116, 147, 171, 224, 275, 291
CviKI_1 RGCY 7 cut(s) 78, 116, 147, 171, 224, 275, 291
CviQI GTAC 1 cut(s) 199
DpnI GATC 4 cut(s) 7, 35, 179, 284
DpnII GATC 4 cut(s) 5, 33, 177, 282
DraI TTTAAA 1 cut(s) 240
EcoRII CCWGG 1 cut(s) 338
FaeI CATG 4 cut(s) 83, 143, 205, 322
FalI AAGNNNNNCTT 2 cut(s) 342, 374
FatI CATG 4 cut(s) 79, 139, 201, 318
FauI CCCGC 1 cut(s) 205
FokI GGATG 1 cut(s) 200
HaeIII GGCC 1 cut(s) 78
Hin1II CATG 4 cut(s) 83, 143, 205, 322
HindIII AAGCTT 1 cut(s) 289
HinfI GANTC 2 cut(s) 267, 407
Hpy188I TCNGA 2 cut(s) 287, 446
Hpy99I CGWCG 1 cut(s) 125
HpyAV CCTTC 2 cut(s) 68, 242
HpyCH4V TGCA 4 cut(s) 30, 56, 110, 394
HpyF10VI GCNNNNNNNGC 1 cut(s) 107
Hsp92II CATG 4 cut(s) 83, 143, 205, 322
Kzo9I GATC 4 cut(s) 5, 33, 177, 282
LpnPI CCDG 7 cut(s) 56, 96, 170, 325, 336, 352, 387
MaeIII GTNAC 1 cut(s) 404
MalI GATC 4 cut(s) 7, 35, 179, 284
MboI GATC 4 cut(s) 5, 33, 177, 282
MboII GAAGA 3 cut(s) 104, 362, 428
MflI RGATCY 1 cut(s) 5
MluCI AATT 4 cut(s) 49, 131, 334, 440
MlyI GAGTC 1 cut(s) 401
MseI TTAA 1 cut(s) 239
MspR9I CCNGG 1 cut(s) 340
MssI GTTTAAAC 1 cut(s) 240
MvaI CCWGG 1 cut(s) 340
MwoI GCNNNNNNNGC 1 cut(s) 107
NdeII GATC 4 cut(s) 5, 33, 177, 282
NlaIII CATG 4 cut(s) 83, 143, 205, 322
NmuCI GTSAC 1 cut(s) 404
PfeI GAWTC 1 cut(s) 267
PflMI CCANNNNNTGG 1 cut(s) 85
PleI GAGTC 1 cut(s) 401
PmeI GTTTAAAC 1 cut(s) 240
PpsI GAGTC 1 cut(s) 401
Psp6I CCWGG 1 cut(s) 338
PspGI CCWGG 1 cut(s) 338
PstI CTGCAG 1 cut(s) 112
PsuI RGATCY 1 cut(s) 5
RsaI GTAC 1 cut(s) 200
RsaNI GTAC 1 cut(s) 199
SaqAI TTAA 1 cut(s) 239
Sau3AI GATC 4 cut(s) 5, 33, 177, 282
SchI GAGTC 1 cut(s) 401
ScrFI CCNGG 1 cut(s) 340
SetI ASST 6 cut(s) 226, 246, 253, 277, 293, 376
SfcI CTRYAG 3 cut(s) 108, 276, 375
SmlI CTYRAG 1 cut(s) 292
SmoI CTYRAG 1 cut(s) 292
Sse9I AATT 4 cut(s) 49, 131, 334, 440
SsiI CCGC 1 cut(s) 212
StyD4I CCNGG 1 cut(s) 338
TaqI TCGA 1 cut(s) 36
TasI AATT 4 cut(s) 49, 131, 334, 440
TatI WGTACW 1 cut(s) 198
TfiI GAWTC 1 cut(s) 267
Tru1I TTAA 1 cut(s) 239
Tru9I TTAA 1 cut(s) 239
TscAI CASTG 1 cut(s) 112
TseFI GTSAC 1 cut(s) 404
Tsp45I GTSAC 1 cut(s) 404
TspDTI ATGAA 2 cut(s) 116, 307
TspGWI ACGGA 1 cut(s) 392
TspRI CASTG 1 cut(s) 112
Van91I CCANNNNNTGG 1 cut(s) 85
XapI RAATTY 2 cut(s) 334, 440
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.