MD14G1029500.v1.1

GMC oxidoreductase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
OG0003277
Physical Location & Seq
Reverse (-)
2583005 .. 2583622
618 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1029500.v1.1.491

Sequence Viewer

Length: 210 bp
ATGGCACTACCAAAGCTTTATATATCCGGAGGGCGGTCTCTCCTCGTGGCTCCTCAAACATCTTTCCTTGCTCATAAGCACATGAAGTTGCACCAACCAGGATTCCAGCGCGAAAGGGTAGTTGTGGAGGGTTTCGGGCATTCGGGTTTGTTGATTGGAGAGATTCTCACAAGACAGTTTTTCCTCACATTTTATCTCCCATACTATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
GMC_oxred_C GMC_oxred_N

Protein Analysis

70

Amino Acids

7.91

Weight (kDa)

9.87

Isoelectric Point (pI)

47.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 111
AccIII TCCGGA 1 cut(s) 26
AciI CCGC 1 cut(s) 34
AfiI CCNNNNNNNGG 1 cut(s) 33
AjnI CCWGG 1 cut(s) 97
AluBI AGCT 1 cut(s) 16
AluI AGCT 1 cut(s) 16
Alw26I GTCTC 1 cut(s) 42
Aor13HI TCCGGA 1 cut(s) 26
AspLEI GCGC 1 cut(s) 111
BauI CACGAG 1 cut(s) 44
BciT130I CCWGG 1 cut(s) 99
BcoDI GTCTC 1 cut(s) 42
Bme1390I CCNGG 1 cut(s) 99
BmiI GGNNCC 1 cut(s) 51
BmrFI CCNGG 1 cut(s) 99
BplI GAGNNNNNCTC 2 cut(s) 150, 182
BsaI GGTCTC 1 cut(s) 42
BsaWI WCCGGW 1 cut(s) 26
Bsc4I CCNNNNNNNGG 1 cut(s) 33
BseAI TCCGGA 1 cut(s) 26
BseBI CCWGG 1 cut(s) 99
BseLI CCNNNNNNNGG 1 cut(s) 33
BseRI GAGGAG 2 cut(s) 32, 42
Bsh1236I CGCG 1 cut(s) 111
BsiSI CCGG 1 cut(s) 27
BslI CCNNNNNNNGG 1 cut(s) 33
BsmAI GTCTC 1 cut(s) 42
BsmI GAATGC 1 cut(s) 139
Bso31I GGTCTC 1 cut(s) 42
Bsp13I TCCGGA 1 cut(s) 26
BspACI CCGC 1 cut(s) 34
BspEI TCCGGA 1 cut(s) 26
BspFNI CGCG 1 cut(s) 111
BspLI GGNNCC 1 cut(s) 51
BspTNI GGTCTC 1 cut(s) 42
BssSI CACGAG 1 cut(s) 44
Bst2BI CACGAG 1 cut(s) 44
Bst2UI CCWGG 1 cut(s) 99
Bst4CI ACNGT 1 cut(s) 177
BstFNI CGCG 1 cut(s) 111
BstHHI GCGC 1 cut(s) 111
BstMAI GTCTC 1 cut(s) 42
BstNI CCWGG 1 cut(s) 99
BstSCI CCNGG 1 cut(s) 97
BstUI CGCG 1 cut(s) 111
CfoI GCGC 1 cut(s) 111
CviAII CATG 1 cut(s) 82
CviJI RGCY 2 cut(s) 16, 50
CviKI_1 RGCY 2 cut(s) 16, 50
Eco31I GGTCTC 1 cut(s) 42
EcoRII CCWGG 1 cut(s) 97
FaeI CATG 1 cut(s) 85
FaiI YATR 5 cut(s) 21, 23, 75, 83, 202
FatI CATG 1 cut(s) 81
GlaI GCGC 1 cut(s) 110
HapII CCGG 1 cut(s) 27
HhaI GCGC 1 cut(s) 111
Hin1II CATG 1 cut(s) 85
Hin6I GCGC 1 cut(s) 109
HinP1I GCGC 1 cut(s) 109
HindIII AAGCTT 1 cut(s) 14
HinfI GANTC 2 cut(s) 102, 163
HpaII CCGG 1 cut(s) 27
Hpy188III TCNNGA 1 cut(s) 27
HpyCH4III ACNGT 1 cut(s) 177
HpyCH4V TGCA 1 cut(s) 91
Hsp92II CATG 1 cut(s) 85
HspAI GCGC 1 cut(s) 109
Kpn2I TCCGGA 1 cut(s) 26
LmnI GCTCC 1 cut(s) 55
LpnPI CCDG 4 cut(s) 40, 84, 111, 119
MnlI CCTC 5 cut(s) 23, 53, 63, 121, 194
MroI TCCGGA 1 cut(s) 26
MspI CCGG 1 cut(s) 27
MspR9I CCNGG 1 cut(s) 99
Mva1269I GAATGC 1 cut(s) 139
MvaI CCWGG 1 cut(s) 99
MvnI CGCG 1 cut(s) 111
NlaIII CATG 1 cut(s) 85
NlaIV GGNNCC 1 cut(s) 51
PctI GAATGC 1 cut(s) 139
PfeI GAWTC 2 cut(s) 102, 163
Psp6I CCWGG 1 cut(s) 97
PspGI CCWGG 1 cut(s) 97
PspN4I GGNNCC 1 cut(s) 51
ScrFI CCNGG 1 cut(s) 99
SetI ASST 1 cut(s) 18
SsiI CCGC 1 cut(s) 34
StyD4I CCNGG 1 cut(s) 97
TaaI ACNGT 1 cut(s) 177
TfiI GAWTC 2 cut(s) 102, 163
TspDTI ATGAA 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.